Labshake search
Citations for Addgene :
1651 - 1700 of 2254 citations for Mouse Cell Surface Hyaluronidase CEMIP2 ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... 4T1 and EMT6.5 cancer cells were transfected with the mammalian expression lentiviral vector pLKO.3 Thy1.1 (Addgene plasmid #14749) containing the surface protein Thy1.1 as a reporter protein ...
-
bioRxiv - Bioengineering 2022Quote: ... Lentivirus was produced using calcium phosphate co-transfection of HEK293T cells with the psPAx2 plasmid (packaging vector, Addgene #12260), pMd2g plasmid (VSVG envelope ...
-
bioRxiv - Cell Biology 2024Quote: ... enables GFP and APEX to be targeted to cilia in many cell types via the N-terminal 203 residues of NPHP3 and was a gift from Maxence Nachury (RRID:Addgene_73186) (Mick et al ...
-
bioRxiv - Cancer Biology 2023Quote: ... 293FT cells were co-transfected with the Lenti-iCas9-neo vector (Addgene plasmid #85400, a gift from Qin Yan) (Cao et al ...
-
bioRxiv - Cancer Biology 2024Quote: Viral particles were packaged in HEK293T cells by transfecting the pLKO.1-shCYB561 constructs or scrambled shRNA pLKO.1 (RRID:Addgene_1864) (30 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Parental HEK293 cells were co-transfected with 1.0 µg each of PBKS-Cas9-2A-eGFP plasmid (Addgene plasmid #68371) and plasmid encoding for gRNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lenti-U6BC-sgDbl/Cre vectors were transfected as a pool into 293T cells with pCMV-VSV-G (Addgene #8454) envelope plasmid and pCMV-dR8.2 dvpr (Addgene #8455 ...
-
bioRxiv - Neuroscience 2023Quote: ... HEK-293T cells were transfected with the respective genome library along with helper plasmids pCAG-B19N (Addgene cat. # 59924), pCAG-B19P (Addgene cat ...
-
bioRxiv - Genomics 2024Quote: Lentivirus was produced from transfected HEK293T cells with packaging vectors (pMD2.G #12259, Addgene, and pCMV-dR8.91, Trono Lab) following the manufacturers protocol (#MIR6605 ...
-
bioRxiv - Microbiology 2023Quote: ... hGM-CSF and hIL-4 were produced from HEK293 cells stably transduced with pAIP-hGMCSF-co (Addgene no. 74168) or pAIP-hIL4-co (Addgene no ...
-
Structural and mechanistic insights into disease-associated endolysosomal exonucleases PLD3 and PLD4bioRxiv - Biochemistry 2023Quote: ... PLD3 KO cell line was generated from HEK293BlueTM hTLR9 by transfecting 2 μg hSpCas9-sgRNA expressing plasmid (Addgene #99154) cloned with gRNA sequence 5′-guccucauucuggcgguugu-3′ ...
-
bioRxiv - Biochemistry 2023Quote: Luciferase reporter assays were performed in MEF cells transfected with a UCP3 reporter plasmid[18] (UCP3 EP1, Addgene #71743) or PGC-1α 2kb promoter (Handschin et al ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids used for CRISPR KO cells lines lentiCRISPR v2 and lentiCRISPR v2-Blast were originally from Feng Zhang (Addgene plasmid # 52961 ...
-
bioRxiv - Neuroscience 2022Quote: ... chr.14 5’-AAGAAAGAAACTTGGCATAG-CAG 14:56,271,668-56,271,690) was assessed in transfected HeLa cells using TurboRFP open reading frame reconstitution reporter plasmid (pAR-TurboRFP; Addgene #60021) as described previously (Kasparek et al. ...
-
bioRxiv - Cell Biology 2022Quote: Lentiviral supernatants were produced in HEK293Lx cells following transfection with 3rd generation packaging plasmids and either pLKOshp53 (Addgene #19119), pLKOshScr (Addgene #1864) ...
-
bioRxiv - Bioengineering 2022Quote: ... To generate H2B-iRFP lentiviral particles HEK 293T cells were plated in a 6-well plate (7×105 cells per well) and transiently transfected with 1.5 μg of pLenti-pGK-DEST-H2B-iRFP vector (Addgene # 90237 ...
-
bioRxiv - Cell Biology 2022Quote: Lentivirus was generated by co-transfecting HEK293T cells with two packaging plasmids (pCMV-VSV-G and delta8.9, Addgene #8454) and the desired transfer plasmid using TransIT-293 transfection reagent (Mirus) ...
-
bioRxiv - Cell Biology 2022Quote: ... hTERT-RPE1 Plk1 FRET Sensor cells were prepared by transfecting Plk1-FRET sensor c-jun substrate plasmid37 (Addgene: 45203) in hTERT-RPE1 cells using X-tremeGENE™ 9 (Merck ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviral particles were produced in 293T cells by using psPAX2 and pCMV-VSV-G packaging plasmids (Addgene 12260, 8454). Viral supernatant was collected after 48h ...
-
bioRxiv - Cancer Biology 2022Quote: ... Retroviral particles were produced in 293T cells by transfecting pCG-gag-pol and pCMV-VSV-G packaging plasmids (Addgene) together with the corresponding retroviral plasmid ...
-
bioRxiv - Molecular Biology 2023Quote: CRISPR mediated mutagenesis of target genes was performed by transducing K562 cells stably expressing Cas9 (lentiCas9-Blast, Addgene #52962) with lentivirus expressing sgRNAs (lentiGuide-Puro ...
-
bioRxiv - Neuroscience 2022Quote: ... N2a cells were co-transfected with the wild-type or FeRIC channels and GCaMP6 (GCaMP6 medium, Addgene cat.40754) or YFP-H148Q ...
-
bioRxiv - Cancer Biology 2023Quote: ... Stable sgCTRL and sgHORMAD1 cell lines were generated using pLX-sgRNA and pCW-Cas9 constructs (Addgene plasmid #50662, #50661) as described previously (Nichols et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... Ptch;p53 primary cell-line(#4954) was transduced using viral particles containing the lentiCas9-Blast vector (Addgene, Watertown, MA; RRID:Addgene_52962). Cells stably expressing Cas9 were selected using 10ug/ml Blasticidin S HCl (Gibco™-#R21001) ...
-
bioRxiv - Microbiology 2023Quote: ... while long-term single-gene knockout cell lines were generated using sgRNAs in pLenti SpBsmBI sgRNA Hygro (Addgene, 62205) containing a hygromycin resistance cassette ...
-
bioRxiv - Cancer Biology 2023Quote: Lentiviral particles were produced in HEK293T cells using psPax2 and pMD2.g second-generation packaging plasmids (Addgene #12260, #12259) with jetPRIME Polyplus transfection reagent ...
-
bioRxiv - Cancer Biology 2023Quote: Derivatives of KP and KPK cells were generated by stable lentiviral transduction of Cas9 with blasticidin resistance (Addgene#52962). Cells were maintained with blasticidin selection throughout the experiment ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were transfected for 6 hours with 80 ng 3xERRE-ERE-luciferase containing codon-modified firefly luciferase (Addgene #37852) and 16 ng pRL-SV40P (Addgene #27163 ...
-
bioRxiv - Cancer Biology 2024Quote: ... HEK293T cells at 80% confluence were transfected with a mix of 1.8 μg gag/pol packaging plasmid (Addgene #14887), 0.7 μg pRev packaging plasmid (Addgene #12253) ...
-
bioRxiv - Cell Biology 2024Quote: ... HeLa Cas9 cells were generated with the lentiCas9-Blast plasmid 87 (Addgene plasmid #52962; http://n2t.net/addgene:52962; RRID: Addgene_52962), a gift from Feng Zhang ...
-
bioRxiv - Molecular Biology 2024Quote: HCT116 cells (eIF6-WT and eIF6-N106S) were transfected with 4µg of pcDNA-firefly-luciferase plasmid DNA (Addgene; 18964) and 20 µL of Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Neuroscience 2024Quote: Single-cell somatodendritic ER Ca2+ levels were monitored using the genetically encoded probe ER-GCaMP6-210 (Addgene no. 86919), which was delivered via an AAV2-based vector (AAV-hsyn-ER-GCaMP150 ...
-
bioRxiv - Immunology 2024Quote: MC-38 OVA cells were generated by inserting the cOVA sequence from PCI-neo-cOVA (a gift from M. Castro, RRID:Addgene_25097), into PB-CMV-MCS-EF1a-Puro PiggyBac vector (PB501b-1 ...
-
bioRxiv - Biochemistry 2024Quote: ... isoform 1) was amplified from K562 cDNA and inserted into insect cell expression vector 438-B (Addgene plasmid: 55219) (N-terminal 6x His (His6 ...
-
bioRxiv - Microbiology 2024Quote: Lentivirus was produced in HEK-293T/17 cells by co-transfection of lentiviral plasmids with psPAX2 (Cat# 12259, Addgene) and pMD2.G (Cat# 12259 ...
-
Direct and indirect regulation of β-glucocerebrosidase by the transcription factors USF2 and ONECUT2bioRxiv - Molecular Biology 2024Quote: LN-229 cells were co-transfected with the plasmid encoding the sgRNAs as outlined below and hCas9 (Addgene #41815) using Lipofectamine 3000 in a ratio of 3:1 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... cells were transfected with 750 ng of an equimolar mixture of three third-generation production plasmids (pMD2.G: Addgene #12259 ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were co-transfected with 850 ng of packaging plasmid psPAX2 (psPAX2 was a gift from Didier Trono, Addgene plasmid # 12260 ...
-
bioRxiv - Cell Biology 2024Quote: ... K19-GFP was cloned into K19-KO cells from pEGFP-K19 plasmid into pLenti CMV Hygro (plasmid #17484. Addgene) using the following primers ...
-
bioRxiv - Bioengineering 2024Quote: ... VSV-G pseudotyped lentivirus was produced via transfection of HEK293 T cells (ATCC, CRL-3216) using psPAX2 (Addgene 12260) and pMD2.G (Addgene 12259) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Parental cells were tagged with firefly luciferase using the MSCV Luciferase PGK-hygro vector (Addgene plasmid #18782, Cambridge, MA) and transduced cells were selected as a pooled population with hygromycin (200µg/mL) ...
-
bioRxiv - Cancer Biology 2024Quote: BCL6 or EZH2 overexpressing cells were obtained by nucleofecting OCI-Ly7 with BCL6 overexpression plasmid pCXN2-BCL6 (Addgene: #40346) or EZH2 WT overexpression plasmid (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... Smpd3wt/wt primary murine pancreatic cancer cell line and cloned into pLenti-CMV-EGFP-Blasticidin lentiviral vector (Addgene, 17445) after removal of eGFP region and switching blasticidin for puromycin.
-
bioRxiv - Cell Biology 2024Quote: ... The following day cells were co-transfected with the M50 Super 8x TOPFlash (a gift from Randall Moon, Addgene plasmid #12456 ...
-
bioRxiv - Evolutionary Biology 2024Quote: The destination plasmids were made by modification of the pAG415-GAL-ccdB-EGFP and pAG415-GAL-EGFP-ccdB from the Yeast Gateway kit (1000000011, Addgene, (Alberti, Gitler et al. 2007)) to create two new plasmids (pARC0031 and pARC0152 ...
-
An mRNA processing pathway suppresses metastasis by governing translational control from the nucleusbioRxiv - Cancer Biology 2021Quote: ... MDA-LM2 and HCC1806-LM2 cells expressing dCas9-KRAB fusion protein were constructed by lentiviral delivery of pMH0006 (Addgene #135448) and FACS isolation of BFP-positive cells.
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were transduced the next day with 1000 ng of plasmid DNA plus 250 ng pMD2.G (Cat# 12259, Addgene) and 750 ng psPax2 (Cat# 12260 ...
-
bioRxiv - Cancer Biology 2021Quote: ... SPRY2 CRISPR oligonucleotides used in A549 cells (gRNA target site: CGTACTGCTCCGCGACCCTG) were cloned into lentiCRISPR v2 plasmid (Addgene pasmid #52961). DUSP6 CRISPR oligonucleotides used in H1299 cells were cloned into lentiCRISPR v2 plasmid (gRNA target site ...
-
bioRxiv - Immunology 2021Quote: ... Lentiviral particles were produced in 293T cells using pMD2.G and psPAX2 (from Didier Trono, Addgene plasmids #12259 and #12260), and pINDUCER-21 plasmids ...
-
bioRxiv - Genetics 2021Quote: ... We introduced this into cells by transfection of 129/B6 XY ESC together with the spCas9 plasmid pX459 (Addgene #62988), carrying a single gRNA sequence complementary for the p53 3’-end ...