Labshake search
Citations for Addgene :
1751 - 1797 of 1797 citations for Penicillin G since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... Production of lentiviral particles was performed by transient co-transfection (polyethylenimine:DNA at 3.5:1 ratio) of HEK 293T cells with the second-generation packaging system plasmid psPAX2 and pMD2.G (Addgene, 12260 and 12259). Viral supernatants were harvested at 48h post-transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... two shRNAs targeting EZH2 (shEZH2-a: CCGGCCCAACATAGATGGACCAAATCTCGAGATTTGGTCCATCTATGTTGGGTTTTT G and shEZH2-b: CCGG CGGAAATCTTAAACCAAGAATCTCGAGATTCTTGGTTTAA GA TTTCCG TTTTTG) were designed and cloned into pLKO.1 vector (Addgene plasmid #10879) according to method by Moffat ...
-
bioRxiv - Immunology 2023Quote: ... were co-transfected with the pHR plasmids and second-generation lentiviral packaging plasmids pMD2.G and psPAX2 (Addgene plasmid #12259 and #12260) using Genejuice transfection reagent (EMD Millipore ...
-
bioRxiv - Cell Biology 2023Quote: Lentiviral expression constructs were packaged in HEK293FT cells using calcium phosphate transfection of psPAX2 and pMD2.G (kind gifts of D. Trono; Addgene #12260, #12259) and pTAT (kind gift of P ...
-
bioRxiv - Cancer Biology 2023Quote: ... third-generation EGFP transfer plasmid pHAGE-CMV-EGFP-W (EvNO00061634, Harvard Plasmid Repository) was mixed with viral envelope plasmid pMD2.G (12259, Addgene, Watertown, MA) and viral packaging plasmid psPAX2 (12260 ...
-
bioRxiv - Cancer Biology 2023Quote: ... HEK293T cells were seeded at 80% density in a 10-cm tissue cell culture treated dish and transfected with the 6 µg of expression plasmid and packaging plasmids 2 µg of pMD2.G (Addgene, cat# 12259) and 4 µg of psPAX2 (Addgene ...
-
bioRxiv - Microbiology 2023Quote: Lentiviruses were generated by co-transfection of vector constructs and second-generation packaging plasmids (psPAX2, Addgene no. 12260 and pMD2.G, Addgene no. 12259), using jetPEI DNA transfection reagent (Polyplus transfection) ...
-
bioRxiv - Neuroscience 2024Quote: ... HEK293T cells were triple transfected with lentivirus packaging plasmid psPAX2 and the envelope plasmid pCMV-VSV-G (Addgene plasmids #12260 and #8454) in addition to the transgene of interest using FuGene HD (Promega) ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were transfected for lentiviral production in media containing 5 μg of each lentiviral packing plasmid (pMD2.G and psPAX2, Addgene: #12259, #12260, respectively), 10 μg of the scramble pLKO.1 or the NNT constructs (named here 1 and 2 ...
-
bioRxiv - Cell Biology 2022Quote: ... The control virus with VSV-G as the tropism and expression of mCherry was generated by co-transfection of pLV-mCherry and pMD2.G vector (Addgene, Watertown, MA, USA) into the Phoenix cells ...
-
bioRxiv - Cancer Biology 2022Quote: ... was purchased from VectorBuilder (Chicago, IL, USA) and the packaging plasmid psPAX2 (#12260) and envelope plasmid pMD2.G (#12259) were obtained from Addgene (Watertown, MA, USA). The plasmid GFP-pLVTHM (#12247 ...
-
bioRxiv - Neuroscience 2021Quote: ... and SAD-B19 helper proteins (N, 52.11 mg, Addgene 59924; P, 30.15 mg, Addgene 59925; L, 23.70 mg, Addgene 59922; G, 20.26 mg, Addgene 59921). Cells were maintained with DMEM with GlutaMAX supplement ...
-
bioRxiv - Molecular Biology 2019Quote: The HIV-derived construct pNL4-3(eGFP)(NL4-3 RRE)(TagBFP) (pHR5580) was packaged and VSV-G pseudotyped using a transient second generation packaging system including psPAX2 (Addgene plasmid 12260, pHR5691) and pMD2.G (Addgene plasmid 12259 ...
-
bioRxiv - Genomics 2019Quote: 293FT cells were transfected with 3rd generation system lentiviral plasmids (pMDLg/pRRE, pRSV-Rev and pMD2.G; Addgene #12251, 12253 and 12259, respectively) to generate viral particles using the PEIpro reagent (Polyplus-Transfection) ...
-
bioRxiv - Cell Biology 2020Quote: ... the Mouse GeCKOv2 CRISPR knockout pooled library plasmids were co-transfected with packaging plasmids pCMV-VSV-G and pCMV-dR8.2 dvpr (Gifts from Bob Weinberg, Addgene plasmid #8485 and #8455) into HEK293T cells ...
-
bioRxiv - Microbiology 2022Quote: Lentiviral particles were generated by co-transfection of the expression constructs and 2nd generation packaging plasmids (psPAX2, Addgene#12260 & pMD2.G, Addgene#12259), using jetPEI DNA transfection reagent (Polyplus transfection ...
-
bioRxiv - Molecular Biology 2024Quote: ... For lentivirus production pCMV-VSV-G (envelope plasmid) and pCMV dR8.2 dvpr (packaging plasmid) were gifts from Bob Weinberg (Addgene # 8454 and #8455, respectively)25 ...
-
bioRxiv - Neuroscience 2023Quote: ... HEK293T cells were transfected with targeting plasmid and 3rd generation packing plasmid (pMD2.G, pMDLg/pRRE; Addgene #12251, and pRSV-Rev; Addgene #12253) together using Lipofectamine 2000 ...
-
bioRxiv - Genetics 2024Quote: ... We next used the Gateway™ LR Clonase™ II Enzyme mix to recombine each of the four PCR products into the pBID-UASC-G backbone (Addgene Plasmid #35202), which contains a φC31 integrase compatible attB sequence and UAS binding sites for the GAL4 expression system (Wang et al ...
-
bioRxiv - Neuroscience 2022Quote: ... ACS-4500) using Lipofectamine 2000 in FBS free Optimem together with the virus packaging plasmids (psPAX2 and pMD2-G, Addgene # 12260 and # 12259) and the plasmid expressing either wild-type U4atac or an Empty Vector ...
-
bioRxiv - Cancer Biology 2023Quote: ... Packaging 293T cells were transfected with KEAP1 single guide RNA (sgRNA) and helper vectors (pMD2.G and psPAX2; Addgene plasmid # 12259 and 12260) using Lipofectamine 3000 reagent (Cat ...
-
bioRxiv - Genetics 2024Quote: ... Lentivirus was produced from sgRNA plasmids by co-transfecting Lenti-X 293T (Takarabio, 632180) cells with the sgRNA plasmid library and packaging plasmids-psPAX2 and pMD2.G (Addgene, 12260 and 12259) using Trans-IT-293 transfection reagent (Mirus ...
-
bioRxiv - Molecular Biology 2021Quote: ... Lentivirus was produced in HEK293T cells using a 2nd generation lentiviral packaging system (psPAX2 – Addgene plasmid #12260 and pMD2.G – Addgene #12259 from Didier Trono) and pRRL.EF1a.HA.NLS.Sce(opt).T2A.BFP (Addgene #32628 from Andrew Scharenberg ...
-
bioRxiv - Cell Biology 2019Quote: ... HEK293T cells were co-transfected using lentiviral packaging plasmids (psPAX2 and pMD2.G) with a PLKO.1-blast plasmid (Addgene, Cambridge, MA, USA, #26655) containing shSmad2 or shYAP ...
-
bioRxiv - Cell Biology 2021Quote: ... or hTMIGD1 cDNAs were generated by co-transfection of HEK293T cells with the lentiviral vector and the packaging vectors psPAX2 and pMD2.G (kindly provided by Dr Didier Trono, Addgene plasmids 12260 and 12259) in a ratio of 3:2:1 into HEK293T cells ...
-
bioRxiv - Cancer Biology 2022Quote: ... method in a non-serum media with lentiviral construct of interest along with lentiviral packaging plasmids psPAX2 and pPMD2.G (Addgene plasmid 12259 and 12260). 8-12 hours post-transfection media was added to the plates supplemented with 10% Fetal Bovine Serum (FBS ...
-
bioRxiv - Neuroscience 2021Quote: ... Lentiviral transfer plasmid libraries were used for virus particle production and titration by the core facility VirusTech at Karolinska Institutet using the packaging plasmids pMD2.G and psPAX2 (a gift from Didier Trono, Addgene plasmids # 12259 and # 12260) or sent to GEG-Tech (Paris ...
-
bioRxiv - Immunology 2019Quote: HEK293T cells were co-transfected with the pHR transfer plasmids with second generation packaging plasmids pMD2.G and psPAX2 (Addgene plasmid #12259 and #12260) using Lipofectamine LTX Reagent (ThermoFisher) ...
-
bioRxiv - Biophysics 2020Quote: ... Lentiviruses were produced in 293T cells by transfecting lentiviruses with the helper plasmids pMD2.G and psPAX2 (a gift from D. Trono, Addgene plasmids #12259 and #12260), following Addgene’s instructions ...
-
bioRxiv - Genetics 2020Quote: Barcoded MSH2-2A-blR cDNA libraries were packaged into lentivirus by co-transfecting HEK293T/17 cells (ATCC) with the transfer plasmid pool plus envelope and packaging vectors (pMD2.G, Addgene #12259 and psPAX2, #12260). For each pool ...
-
bioRxiv - Microbiology 2020Quote: Lentiviruses derived from pLKO or pGIPZ were derived from transfection of 293T cells with packaging plasmids pMD2.G and psPAX2 (gifts from Didier Trono Addgene plasmids 12259 and 12260) using polyethylenimine MAX (polysciences #24765) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Lentiviral particles were then prepared by cotransfection of pLentiCRISPRv2 constructs into HEK293T cells with pCMV-VSV-G (Addgene #8454, a gift from Bob Weinberg) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Viral supernatants were prepared by transfection of HEK293T cells with the vector plasmids and packaging plasmids (psPAX2 Addgene 12259 and pMD2.G Addgene 12260). The transfection was performed with polyethylenimine (PEI MAX Transfection Grade Linear Polyethylenimine Hydrochloride ...
-
bioRxiv - Cancer Biology 2022Quote: 293T cells were transfected with packaging plasmids (8 μg of pCMV-dR8.2 dVPR and 1 μg pCMV-VSV-G, a gift from Robert Weinberg, Addgene plasmid #8455 and 8454, respectively) along with shRNA plasmids (8 μg ...
-
bioRxiv - Cell Biology 2023Quote: Lentiviruses were generated in HEK293T cells by transient expression of the indicated shRNA vectors below with psPAX2 and pMD2.G packaging vectors (Addgene plasmids 11260 and 12259). For lentiviral production in 96 well plates ...
-
bioRxiv - Biophysics 2023Quote: ... co-transfection of pHR transfer plasmids with second-generation packaging plasmids pMD2.G and psPAX2 (a gift from Didier Trono, Addgene plasmid #12259 and #12260) was done to produce lentivirus in HEK293T cells ...
-
bioRxiv - Cell Biology 2023Quote: ... Lentiviruses were generated in HEK293T cells by transient expression of the vectors with pSPAX2 and pMD2.G packaging vectors (Addgene plasmids #12260 and #12259). Viral supernatants were collected after 48 h of expression and passed through a 45 μm syringe filter before exposure to target cells.
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviruses were generated by transfecting sub-confluent HEK293T cells along with the lentiviral vector and packaging vectors pCMV-VSV-G (Addgene, Cat. 8454, RRID: Addgene_8454) and psPAX2 (Addgene ...
-
bioRxiv - Cancer Biology 2020Quote: ... MSCV vector containing either nothing (empty vector) or the CTAG1A gene were co-transfected in 293FT with pMD2.G and pUMVC (Addgene #8449, gift from Bob Weinberg) at a ratio of ∼1.5:1.2:1.8 ...
-
bioRxiv - Microbiology 2022Quote: Lentivirus was produced in HEK293T by co-transfection of cDNA containing lentiviral plasmid together with helper plasmids pMD2.G (Addgene #12259, gift from Didier Trono) and pCMV-dR8.91 (Life Science Market ...
-
bioRxiv - Cancer Biology 2022Quote: ... at 70-80% confluency were co-transfected with the lentiviral plasmid and lentiviral helper plasmids (psPAX2: Addgene #12260 and pMD2.G: Addgene #12259, gifts from Didier Trono) using PureFection (SBI System Biosciences ...
-
bioRxiv - Cancer Biology 2023Quote: Retrovirus vectors were generated by co-transfecting the LKB1-containing plasmids with the pCMV-VSV-G packaging plasmid (Addgene 8454, a gift from Robert Weinberg) into GP2-293 cells (Takara 631458) ...
-
bioRxiv - Cell Biology 2023Quote: ... at roughly 80% confluency with 4.5μg of an equimolar mixture of three plasmids encoding the envelope and viral packaging components from the laboratory of Didier Trono (pMD2.G: Addgene 12259; pRSV-Rev: Addgene 12253; pMDLg/pRRE: Addgene 12251). 4.5μg of lentiviral donor plasmid was added to the mixture and incubated for 20 min with 10μL of polyethylenimine (PEI ...
-
bioRxiv - Developmental Biology 2021Quote: ... using program A-30 with 1.6 µg each of GFP and tdTomato circularised targeting vectors and 5 µg single gRNA vector PX459 (5’-TATACCTAATCATTATGCCG-3’) (Addgene, 48139, a gift from Feng Zhang). Homology arms flanking the target site were amplified from genomic DNA and cloned into pBluescript II SK(+ ...
-
bioRxiv - Microbiology 2022Quote: All lentiviruses vector particles were generated in HEK-293T cells by co-transfection with plasmids pMD2.g and psPAX2 (Addgene # 12259, #12260, gift of Didier Trono), exactly as described previously (43) ...
-
bioRxiv - Cell Biology 2024Quote: ... Lentivirus was produced from pLenti-SV40-T-tsA58 (abm cat# LV629) as previously described (51) using the VSV envelope from pMD2.G (Addgene cat#12259, gift from Didier Trono) and the packaging plasmid pCMV delta R8.2 (Addgene cat # 12263 ...
-
bioRxiv - Systems Biology 2022Quote: ... cells were transfected with 750ng of an equimolar mixture of the three third-generation envelope and packaging plasmids (pMD2.G: Addgene #12259; pRSV-Rev: Addgene #12253; pMDLg/pRRE: Addgene #12251, all gifts from Didier Trono) and 750ng of lentiviral transfer plasmid encoding the transgene of interest after a 15 minute incubation of these plasmids with 10μL of polyethylenimine (PEI ...