Labshake search
Citations for Addgene :
1651 - 1700 of 1797 citations for Penicillin G since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... NPC were then transduced with a VSV-G-pseudotyped lentivirus (carrying pCW57.1 plasmid from Addgene # 41393 (gift from David Root) modified to include hNGN2 under the doxycycline promoter) ...
-
bioRxiv - Neuroscience 2024Quote: ... the DNA mixture consisted in 20 μg of specific DNA and 10 μg each of psPax2 and pMD2.G plasmids (from Dr. Didier Trono, Addgene) and 250 mM CaCl2 (in a final volume of 500 ul ...
-
bioRxiv - Cell Biology 2023Quote: ... to co- transfect HEK 293FT cells with plasmids containing the packaging gag/pol and envelope pCMV- 435VSV-G genes and either the pMRX-IB-HaloTag7-mGFP-KDEL (Addgene, 184904 ...
-
bioRxiv - Genomics 2024Quote: ... Lentivirus was produced in HEK293T cells co-expressing the shRNA plasmid together with psPAX2 packaging plasmid and pVSV-G envelope plasmid (Addgene). Virus was concentrated using Lenti-X Concentrator (Takara ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviral particles were generated by transfecting HEK 293T cells with 12 μg of pLJM1-mEGFP or pLJM1ALKBH5 plasmids with 6 μg of psPAX2 packaging plasmid and 2 μg of pMD2.G envelope plasmid (Addgene). The medium was replaced 16h after transfection ...
-
bioRxiv - Cell Biology 2024Quote: ... The lentiviral vector lentiCRISPRv2 carrying both Cas9 enzyme and a gRNA transfected into HEK293T cells together with the packaging plasmids psPAX2 and pCMV-VSV-G (Addgene) at the ratio of 5:3:2 ...
-
bioRxiv - Cell Biology 2023Quote: ... the lentiviral vectors encoding each SLX4 cDNA (kindly provided by Dr. Minoru Takata) were individually co-transfected with two assistant vectors pMD2.G (#12259, Addgene) and psPAX2 (#12260 ...
-
bioRxiv - Cancer Biology 2023Quote: Lentivirus particles were produced in the packaging cell line HEK293T using packaging vectors psPAX2 and pMD2.G (both from Addgene). Plasmids were transfected with polyethyleneimine (PEI ...
-
bioRxiv - Biochemistry 2023Quote: ... Lentiviruses with this construct were produced by transfecting human embryonic kidney 293T (HEK 293T) cells with pKS18 and the lentiviral packaging vectors pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentivirus supernatants were prepared by co-transfecting the Tet-pLKO-puro plasmid along with helper plasmids pVSV-G (Addgene #138479) and p8.92 (Addgene #132929 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentiviral supernatants were by transient co-transfection of individual constructs with packaging plasmids (psPAX2, Addgene #12260 and pMD2.G, Addgene #12259 into HEK-293T cells using X-tremeGENE HP DNA transfection reagent (#06366236001 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The packaging plasmids pCMV-VSV-g (cat# 8454) and pS-PAX2 (cat# 12260) were obtained from Addgene (Watertown, MA, USA).
-
bioRxiv - Immunology 2023Quote: ... LentiCRISPRv2–sgRNA Myc transfer plasmids was co-transfected with packaging plasmids psPAX2 and pMD2.G (Addgene plasmids #12259 and #12260) into HEK293T cells ...
-
bioRxiv - Immunology 2023Quote: ... HEK293T cells were transfected with sgRNA-or cDNA-encoding lentiviral vectors and packaging plasmids psPAX2 and pMD2.G (plasmid no. 12260 and plasmid no. 12259 from Addgene) using PEI (Sigma) ...
-
bioRxiv - Cancer Biology 2023Quote: ... These lentiviral constructs along with packaging plasmid (pCMV delta R8.2 dvpr, addgene#8455) and envelope plasmid (pCMV-VSV-G, Addgene#8454) were used for lipofectamine 2000 mediated transfection of 293FT cells to produce lentiviral pseudo typed particles ...
-
bioRxiv - Microbiology 2023Quote: ... ANP32B or a non-targeting control gRNA as well as with the packaging plasmids pMD2.G and psPAX2 (gifts from Didier Trono, Addgene plasmids # 12259 and # 12260 ...
-
bioRxiv - Biochemistry 2023Quote: ... 8 µg psPAX2 packaging plasmid DNA and 1 µg pMD2.G envelope plasmid DNA (both gifts from Didier Trono, Addgene plasmid no ...
-
bioRxiv - Cell Biology 2023Quote: ... at roughly 80% confluency with 4.5μg of an equimolar mixture of three plasmids encoding the envelope and viral packaging components from the laboratory of Didier Trono (pMD2.G: Addgene 12259 ...
-
bioRxiv - Molecular Biology 2023Quote: For pseudotyping rVSV-ΔG*RenLuc with rabies spike protein the residues 1 - 485 including the ecto- and transmembrane domains but excluding the cytoplasmic tail of RABV-G (ERA strain, UniProtKB ID: P03524.1, residue numbering includes signal peptide) were cloned into pEBB vector (Addgene #22226), resulting in plasmid pEBB-R0CT ...
-
bioRxiv - Microbiology 2023Quote: ... in 293-LTV cells transfected using jetPRIME (Polypus 101000027) with plasmids pCMV-VSV-G (a gift from Bob Weinberg Addgene plasmid # 8454 ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 µg of pX330 plasmid containing sgRNA for the target protein and 0.2 µg of pcDNA3-FKBP-eGFP-HOTag3 (Addgene, #106924) were co-transfected using Lipofectamine 2000 (Thermo Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... with the shRNA vector and Virapower packaging plasmids (pMDLg/pRRE, Addgene #12251; pRSV-Rev, Addgene #12253; pMD2.G, Addgene #12259) according to manufacturer instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... with the shRNA vector and Virapower packaging plasmids (pMDLg/pRRE, Addgene #12251; pRSV-Rev, Addgene #12253; pMD2.G, Addgene #12259) according to manufacturer instructions ...
-
bioRxiv - Cell Biology 2023Quote: After production of recombinant lentiviruses in HEK293T cells by co-transfection of the pLentiCRISPRv2 constructs with pMD2.G and psPAX2 (Addgene plasmids #12259 and #12260 ...
-
bioRxiv - Immunology 2024Quote: 293T cells were seeded in 6-well plates and transfected with the prISG15-Renilla-hPEST-IRES-Puro construct together with psPAX2 and pMD2.G (Addgene plasmids #12259 and #12260 ...
-
bioRxiv - Cell Biology 2024Quote: ... 18 million 293FT cells were seeded in T225 flasks (40 flasks in total) and transfected the following day with 3.4 μg pMD2.G (Addgene #12259), 6.8 μg psPAX2 (Addgene#12260) ...
-
bioRxiv - Neuroscience 2024Quote: ... Lentivirus encoding both LifeAct-RFP and EB3-YFP (cloned in a PLV-mCherry derived vector) were produced by co-transfection with the psPAX2 and pCMV-VSV-G helper plasmids (Addgene plasmids # 12260 and # 8454 ...
-
bioRxiv - Cell Biology 2024Quote: ... 700,000 HEK293T cells were seeded onto a 6-well plate and 24 hours later transfected with 200 ng pMD2.G (Addgene), 400 ng psPAX2 (Addgene) ...
-
bioRxiv - Microbiology 2024Quote: ... BHK-21/WI-2 culture supernatants were filtered (0.22 μm) and used to inoculate 293T cells that had been transfected 24 h previously with pMD2.G (Addgene 12259). At 24 h post-inoculation ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviruses were generated by transfecting sub-confluent HEK293T cells along with the lentiviral vector and packaging vectors pCMV-VSV-G (Addgene, Cat. 8454, RRID: Addgene_8454) and psPAX2 (Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were transfected with the plasmid of interest (mentioned in ‘Cloning of H3S10 variant plasmids’) and the lentiviral packaging plasmid pCMV-VSV-G a gift from Bob Weinberg (Addgene plasmid #8454 ...
-
bioRxiv - Genomics 2024Quote: Lentivirus was produced via transfection of pooled library plasmids with appropriate packaging plasmids (psPAX2-Addgene 12260; pMD2.G-Addgene 12259) using linear polyethylenimine (PEI ...
-
bioRxiv - Genomics 2024Quote: Lentivirus was produced via transfection of pooled library plasmids with appropriate packaging plasmids (psPAX2-Addgene 12260; pMD2.G-Addgene 12259) using linear polyethylenimine (PEI ...
-
bioRxiv - Neuroscience 2021Quote: ... We applied our system to the SAD-B19 genome plasmid in which the G gene has been replaced by EGFP (cSPBN-4GFP, Addgene #5248715), targeting the barcode cassette to the 3’ UTR of EGFP adjacent to the viral polyadenylation sequence53 ...
-
bioRxiv - Physiology 2019Quote: ... pLKO.1 scrambled shRNA or Sirt4 shRNA was transfected in HEK293 T cells with packaging plasmids pMD2.G (Addgene plasmid # 12259) and psPAX2 (Addgene plasmid # 12260) ...
-
bioRxiv - Biophysics 2021Quote: ... were transfected in DMEM with 2 % (v/v) FBS with 12 μg of pHR-CMV-TetO2 construct vector alongside 11 μg envelope plasmid (pMD2.G; Addgene #12259) and 11 μg packaging plasmid (psPAX2 ...
-
bioRxiv - Cell Biology 2021Quote: ... Lentiviruses were produced by transfecting HEK-293T cells with the transfer lentiCRISPR v2 plasmids and packaging plasmids pLTR-G (Addgene, 17532) and pCD/NL-BH*DDD (Addgene ...
-
bioRxiv - Plant Biology 2021Quote: ... 1 μg plasmid/transformation for the gene of interest and 0.5 μg plasmid/transformation of transformation marker (pUbi_GUSplus, Addgene, encoding ß-Glucuronidase) was applied.
-
bioRxiv - Cancer Biology 2020Quote: The dCas9-KRAB constructs were transfected in 293T cells with the 2nd generation lentiviral packaging and envelope plasmids psPAX2 and pMD2.g (Addgene, USA), using CaCl2 2.5M (Sigma ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1.5 × 107 293T cells in 150Lmm tissue culture dishes were transfected with 18☐μg of each plasmid DNA along with 4.5 μg of pMD2.G (Addgene #12259) and 9 μg of psPAX2 packaging vectors (Addgene #12260 ...
-
bioRxiv - Cell Biology 2022Quote: ... the following packaging and envelop plasmids were added to all of the 10-cm dishes as well: psPAX2 (6 μg) and pMD2.G (0.75 μg, Addgene, catalog #: 12259). psPAX2 (Addgene plasmid # 12260 ...
-
bioRxiv - Microbiology 2021Quote: ... the mutant constructs were co-transfected with psPAX2 and also the VSVg plasmid pMD2.G (Addgene; courtesy of Dr Didier Trono) at a molar ratio of 2:1:1 to increase the infection rate ...
-
bioRxiv - Developmental Biology 2021Quote: Retrovirus for GFP labeling was produced from 293gp NIT-GFP packaging cells by transfection with pCMV-VSV-G plasmid (Addgene #8454). Viral particles with low titer of about 106 PFU/ml were used for infection ...
-
bioRxiv - Biochemistry 2020Quote: ... Lentiviral particles expressing the above proteins were produced by co-transfecting expression plasmids individually with a second generation lentiviral packaging construct psPAX2 (courtesy of Dr Didier Trono through NIH AIDS repository) and VSVG plasmid pMD2.G (Addgene#2259) in HEK293T cells (Life Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... transfections were performed using the the pLenti-CMV-DEST vectors together with the lentivirus envelope and package plasmids pMD2.G (Addgene, #12259) and psPAX2 (Addgene ...
-
bioRxiv - Cancer Biology 2020Quote: ... HEK293T cells were transfected with each TGF-β1 shRNA construct along with packaging vectors pMD2.G (0.5 μg) and psPAX2 (1.5 μg) (Addgene, Inc., Watertown, MA) using Jet Prime Reagent (Polyplus-transfection® ...
-
bioRxiv - Immunology 2020Quote: ... GTG ACT GGC CAA GCC GTA G) were synthesised according to Sanjana et al (28) and cloned into pSpCas9(BB)-2A-GFP (Addgene, #48138) following BbsI digestion ...
-
bioRxiv - Neuroscience 2019Quote: ... as described(Wickersham et al., 2015) but with the use of the vesicular stomatitis virus envelope expression plasmid pMD2.G (Addgene 12259) for all vectors except for LV-U-TVA950(B19G) ...
-
bioRxiv - Biochemistry 2021Quote: ... and ER lumen ([Ca2+]ER) were monitored using G-GECO1.1 (a gift from Robert Campbell from University of Alberta; Addgene plasmid #32445) (Zhao et al. ...
-
bioRxiv - Immunology 2021Quote: ... produced in HEK293FT cells transiently transfected with two packaging plasmids (psPAX2 and pMD2-G) and the lentiCRISPR v2 plasmid (Addgene #52961)11 containing a non-targeting (GGCATCTTAACTAATCGTCT ...