Labshake search
Citations for Addgene :
1601 - 1650 of 1668 citations for Penicillin G since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Cas13d-mediated isoform-specific RNA knockdown with a unified computational and experimental toolboxbioRxiv - Genomics 2023Quote: Lentivirus was produced via transfection of library plasmid pool and appropriate packaging plasmids (psPAX2, Addgene #12260 and pMD2.G, Addgene #12259) using linear polyethylenimine MW25000 (Polysciences ...
-
bioRxiv - Microbiology 2023Quote: ... lentiviral particles expressing the above genes were produced by co-transfecting expression plasmids individually with a 2nd generation lentiviral packaging construct psPAX2 (courtesy of Dr Didier Trono through NIH AIDS repository) and VSVG plasmid pMD2.G (Addgene, 2259) in HEK293T producer cells using polyethyleneimine as previously described 54.Virus supernatant was collected 72 h post-transfection ...
-
bioRxiv - Developmental Biology 2023Quote: ... lentiviral supernatants were generated by transfecting one 10-cm plate of HEK-293T cells at 90% confluency with 3 µg pMD2.G (Addgene #12259), 9 µg psPAX2 (Addgene #12260) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Lentiviral particles containing the CD19 CAR element were produced by lipofectamine-based co-transfection of HEK293 cells with 3rd generation packaging plasmids pMD2.G (Addgene, #12259), pMDLg/pRRE (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... HEK293T cells were transfected with targeting plasmid and 3rd generation packing plasmid (pMD2.G, pMDLg/pRRE; Addgene #12251, and pRSV-Rev; Addgene #12253) together using Lipofectamine 2000 ...
-
bioRxiv - Genomics 2024Quote: ... 4.5 x 106 cells were transfected using the calcium phosphate precipitation method (Salmon and Trono, 2007) with 6 μg pMD2.G (Addgene #12259), 15 μg psPAX2 (Addgene #12260 ...
-
bioRxiv - Cancer Biology 2021Quote: ... or the third-generation EGFP transfer plasmid pHAGE-CMV-EGFP-W (EvNO00061634, Harvard Plasmid Repository) were mixed with viral envelope plasmid pMD2.G (12259, Addgene, Watertown, MA) and viral packaging plasmid psPAX2 (12260 ...
-
bioRxiv - Biochemistry 2021Quote: ... The lentivirus envelope and packaging plasmids pMD2.G and pCMV delta R8.2 were gifts from Didier Trono (Addgene plasmids # 12259 and 12263). Plasmids containing human TIM-1 and human TIM-4 were obtained from Origene ...
-
bioRxiv - Molecular Biology 2021Quote: VSV-G envelope pseudo-typed lentivirus for the generation of stable cell lines was produced by co-transfection of each transfer plasmid with pCMVdR 8.91 71 and pCMV-VSV-G (gift from Prof. Weinberg, Addgene plasmid # 8454 72). 72 h post-transfection ...
-
bioRxiv - Developmental Biology 2022Quote: HEK293T cells were grown in 10-cm dishes to 80% confluency before transfection with the lentiviral vector (10 µg) with packaging vectors including pMD2.G (3 µg, Addgene plasmid # 12259), psPAX2 (6 µg ...
-
bioRxiv - Molecular Biology 2019Quote: An N-terminal FLAG tag sequence was appended via Gibson Assembly Cloning (New England Biosciences) to a human codon optimized Cas9 (subcloned from hCas9, a gift from G. Church, Harvard; Addgene plasmid 41815) with a single C-terminal NLS expressed from a pcDNA3.3-TOPO vector ...
-
bioRxiv - Developmental Biology 2021Quote: We grew HEK293T cells in 10-cm dishes to a confluence of 80% before we transfected the lentiviral vector (10 µg) with packaging vectors including pMD2.G (3 µg, Addgene plasmid # 12259), psPAX2 (6 µg ...
-
bioRxiv - Cell Biology 2021Quote: ... HEK 293 cells were transfected with pLJM1-eGFP or pLJM1-DN-FYN plasmid together with lentivirus packing and envelope plasmids pMD2.G (gift from Didier Trono, Addgene plasmid# 12259) and psPAX2 (gift from Didier Trono ...
-
bioRxiv - Biochemistry 2021Quote: Lentiviral expression constructs were packaged in HEK293FT cells using calcium phosphate transfection of psPAX2 and pMD2.G (kind gifts of D. Trono; Addgene #12260, 12259) and pTAT (kind gift of P ...
-
bioRxiv - Biophysics 2022Quote: ... media was refreshed with standard growth media and cells were co-transfected with SNAP-mGluR2 (no FLAG-tag) and chimeric G protein (Gqo5, Addgene plasmid #24500) (1:2 w/w ...
-
bioRxiv - Plant Biology 2022Quote: ... the CP or MP fragments were cloned into vector L4440gtwy that includes attR sites flanked by T7 promoters (G. Caldwell, Addgene plasmid # 11,344) using LR clonase (Thermo Scientific ...
-
bioRxiv - Immunology 2020Quote: ... the lentiCas9-v2 lentivirus were produced from HEK-293FT cells transfected with the lentiCas9-v2 plasmid mixed at a 2:1:1 DNA ratio of the lentiviral packaging plasmids pMD2.G (Addgene plasmid #12259) and psPAX2 (Addgene plasmid #12260 ...
-
bioRxiv - Genomics 2019Quote: ... were seeded in a 12-well plate and cultured for 24 h before transfection with Sp1-luciferase reporter plasmid DNA (0.5 g; Panomics, Fremont, CA, USA) or a 3× ERE TATA luc construct (Addgene, Cambridge, MA, USA) for 24 h ...
-
bioRxiv - Cancer Biology 2021Quote: Oligos targeting p53 were annealed and inserted into lentiCRISPR v2 (gift of Feng Zhang) as described previously (Sanjana et al., 2014; Shalem et al., 2014) The lentiviral packaging plasmids pMD2.G (Addgene plasmid #12259) and psPAX2 (Addgene plasmid #12260 ...
-
bioRxiv - Immunology 2021Quote: Lentiviruses were generated by co-transfection of lentiCRISPR v2 constructs and packaging plasmids (psPAX2, Addgene no. 12260 and pMD2.G, Addgene no. 12259), using PEI DNA transfection reagent (Shanghai maokang biotechnology) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Lentivirus was generated using 293FT cells by co-transfection of guide plasmid with psPAX2 and pMD2.G (Addgene, 12260 and 12259, respectively). Conditioned media was harvested ...
-
bioRxiv - Cell Biology 2022Quote: ... Plasmid psPAX2 was a gift from Didier Trono (Ad-dgene plasmid #12260) and pMD2.G was a gift from Didier Trono (Addgene plasmid #12259). A7R5 cells were induced towards the contractile phenotype using serum starvation ...
-
bioRxiv - Genomics 2022Quote: Lentiviral particles were produced by transfecting 293T-17 cells (ATCC: CRL-11268) with the envelope construct pCMV-VSV-G (Addgene plasmid 8454), the packaging construct pCMV-dR8.2 dvpr (Addgene plasmid 8455) ...
-
bioRxiv - Developmental Biology 2022Quote: ... HEK293T cells at 70-80% confluency in 10 cm dishes were transfected with the insert construct plus 3rd generation packaging plasmids: pMD2.G (3 μg, Addgene plasmid #12259), psPAX2 (6 μg ...
-
bioRxiv - Cell Biology 2023Quote: Lentiviral expression constructs were packaged in HEK293FT cells using calcium phosphate transfection of psPAX2 and pMD2.G (kind gifts of D. Trono; Addgene #12260, #12259) and pTAT (kind gift of P ...
-
bioRxiv - Cancer Biology 2023Quote: ... third-generation EGFP transfer plasmid pHAGE-CMV-EGFP-W (EvNO00061634, Harvard Plasmid Repository) was mixed with viral envelope plasmid pMD2.G (12259, Addgene, Watertown, MA) and viral packaging plasmid psPAX2 (12260 ...
-
bioRxiv - Cancer Biology 2023Quote: ... HEK293T cells were seeded at 80% density in a 10-cm tissue cell culture treated dish and transfected with the 6 µg of expression plasmid and packaging plasmids 2 µg of pMD2.G (Addgene, cat# 12259) and 4 µg of psPAX2 (Addgene ...
-
bioRxiv - Microbiology 2023Quote: Lentiviruses were generated by co-transfection of vector constructs and second-generation packaging plasmids (psPAX2, Addgene no. 12260 and pMD2.G, Addgene no. 12259), using jetPEI DNA transfection reagent (Polyplus transfection) ...
-
bioRxiv - Cell Biology 2023Quote: ... two shRNAs targeting EZH2 (shEZH2-a: CCGGCCCAACATAGATGGACCAAATCTCGAGATTTGGTCCATCTATGTTGGGTTTTT G and shEZH2-b: CCGG CGGAAATCTTAAACCAAGAATCTCGAGATTCTTGGTTTAA GA TTTCCG TTTTTG) were designed and cloned into pLKO.1 vector (Addgene plasmid #10879) according to method by Moffat ...
-
bioRxiv - Immunology 2023Quote: ... were co-transfected with the pHR plasmids and second-generation lentiviral packaging plasmids pMD2.G and psPAX2 (Addgene plasmid #12259 and #12260) using Genejuice transfection reagent (EMD Millipore ...
-
bioRxiv - Immunology 2024Quote: ... Production of lentiviral particles was performed by transient co-transfection (polyethylenimine:DNA at 3.5:1 ratio) of HEK 293T cells with the second-generation packaging system plasmid psPAX2 and pMD2.G (Addgene, 12260 and 12259). Viral supernatants were harvested at 48h post-transfection ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were transfected for lentiviral production in media containing 5 μg of each lentiviral packing plasmid (pMD2.G and psPAX2, Addgene: #12259, #12260, respectively), 10 μg of the scramble pLKO.1 or the NNT constructs (named here 1 and 2 ...
-
bioRxiv - Cell Biology 2022Quote: ... The control virus with VSV-G as the tropism and expression of mCherry was generated by co-transfection of pLV-mCherry and pMD2.G vector (Addgene, Watertown, MA, USA) into the Phoenix cells ...
-
bioRxiv - Cancer Biology 2022Quote: ... was purchased from VectorBuilder (Chicago, IL, USA) and the packaging plasmid psPAX2 (#12260) and envelope plasmid pMD2.G (#12259) were obtained from Addgene (Watertown, MA, USA). The plasmid GFP-pLVTHM (#12247 ...
-
bioRxiv - Neuroscience 2021Quote: ... and SAD-B19 helper proteins (N, 52.11 mg, Addgene 59924; P, 30.15 mg, Addgene 59925; L, 23.70 mg, Addgene 59922; G, 20.26 mg, Addgene 59921). Cells were maintained with DMEM with GlutaMAX supplement ...
-
bioRxiv - Molecular Biology 2019Quote: The HIV-derived construct pNL4-3(eGFP)(NL4-3 RRE)(TagBFP) (pHR5580) was packaged and VSV-G pseudotyped using a transient second generation packaging system including psPAX2 (Addgene plasmid 12260, pHR5691) and pMD2.G (Addgene plasmid 12259 ...
-
bioRxiv - Genomics 2019Quote: 293FT cells were transfected with 3rd generation system lentiviral plasmids (pMDLg/pRRE, pRSV-Rev and pMD2.G; Addgene #12251, 12253 and 12259, respectively) to generate viral particles using the PEIpro reagent (Polyplus-Transfection) ...
-
bioRxiv - Cell Biology 2020Quote: ... the Mouse GeCKOv2 CRISPR knockout pooled library plasmids were co-transfected with packaging plasmids pCMV-VSV-G and pCMV-dR8.2 dvpr (Gifts from Bob Weinberg, Addgene plasmid #8485 and #8455) into HEK293T cells ...
-
bioRxiv - Microbiology 2022Quote: Lentiviral particles were generated by co-transfection of the expression constructs and 2nd generation packaging plasmids (psPAX2, Addgene#12260 & pMD2.G, Addgene#12259), using jetPEI DNA transfection reagent (Polyplus transfection ...
-
bioRxiv - Neuroscience 2022Quote: ... ACS-4500) using Lipofectamine 2000 in FBS free Optimem together with the virus packaging plasmids (psPAX2 and pMD2-G, Addgene # 12260 and # 12259) and the plasmid expressing either wild-type U4atac or an Empty Vector ...
-
bioRxiv - Cancer Biology 2023Quote: ... Packaging 293T cells were transfected with KEAP1 single guide RNA (sgRNA) and helper vectors (pMD2.G and psPAX2; Addgene plasmid # 12259 and 12260) using Lipofectamine 3000 reagent (Cat ...
-
bioRxiv - Molecular Biology 2024Quote: ... For lentivirus production pCMV-VSV-G (envelope plasmid) and pCMV dR8.2 dvpr (packaging plasmid) were gifts from Bob Weinberg (Addgene # 8454 and #8455, respectively)25 ...
-
bioRxiv - Neuroscience 2023Quote: ... HEK293T cells were transfected with targeting plasmid and 3rd generation packing plasmid (pMD2.G, pMDLg/pRRE; Addgene #12251, and pRSV-Rev; Addgene #12253) together using Lipofectamine 2000 ...
-
bioRxiv - Genetics 2024Quote: ... We next used the Gateway™ LR Clonase™ II Enzyme mix to recombine each of the four PCR products into the pBID-UASC-G backbone (Addgene Plasmid #35202), which contains a φC31 integrase compatible attB sequence and UAS binding sites for the GAL4 expression system (Wang et al ...
-
bioRxiv - Molecular Biology 2021Quote: ... Lentivirus was produced in HEK293T cells using a 2nd generation lentiviral packaging system (psPAX2 – Addgene plasmid #12260 and pMD2.G – Addgene #12259 from Didier Trono) and pRRL.EF1a.HA.NLS.Sce(opt).T2A.BFP (Addgene #32628 from Andrew Scharenberg ...
-
bioRxiv - Cell Biology 2019Quote: ... HEK293T cells were co-transfected using lentiviral packaging plasmids (psPAX2 and pMD2.G) with a PLKO.1-blast plasmid (Addgene, Cambridge, MA, USA, #26655) containing shSmad2 or shYAP ...
-
bioRxiv - Cell Biology 2021Quote: ... or hTMIGD1 cDNAs were generated by co-transfection of HEK293T cells with the lentiviral vector and the packaging vectors psPAX2 and pMD2.G (kindly provided by Dr Didier Trono, Addgene plasmids 12260 and 12259) in a ratio of 3:2:1 into HEK293T cells ...
-
bioRxiv - Cancer Biology 2022Quote: ... method in a non-serum media with lentiviral construct of interest along with lentiviral packaging plasmids psPAX2 and pPMD2.G (Addgene plasmid 12259 and 12260). 8-12 hours post-transfection media was added to the plates supplemented with 10% Fetal Bovine Serum (FBS ...
-
bioRxiv - Neuroscience 2021Quote: ... Lentiviral transfer plasmid libraries were used for virus particle production and titration by the core facility VirusTech at Karolinska Institutet using the packaging plasmids pMD2.G and psPAX2 (a gift from Didier Trono, Addgene plasmids # 12259 and # 12260) or sent to GEG-Tech (Paris ...
-
bioRxiv - Immunology 2019Quote: HEK293T cells were co-transfected with the pHR transfer plasmids with second generation packaging plasmids pMD2.G and psPAX2 (Addgene plasmid #12259 and #12260) using Lipofectamine LTX Reagent (ThermoFisher) ...