Labshake search
Citations for Addgene :
1451 - 1500 of 1668 citations for Penicillin G since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Retroviral particles were produced in 293T cells by transfecting pCG-gag-pol and pCMV-VSV-G packaging plasmids (Addgene) together with the corresponding retroviral plasmid ...
-
bioRxiv - Neuroscience 2022Quote: ... The constructs were provided with a packaging vector (Pax2, 12.5 µg) and the envelope protein VSV-G (3.3 µg, Addgene, #8454) in Opti-MEM medium to which the transfection reagent Polyethylenimine (1 mg/ml ...
-
bioRxiv - Molecular Biology 2022Quote: ... The gene encoding Cas3/I-G was cloned into pET Strep II TEV LIC cloning vector (1R, Addgene #29664). All the clones were confirmed by Sanger sequencing ...
-
bioRxiv - Biochemistry 2023Quote: ... cells with pKS18 and the lentiviral packaging vectors pMD2.G (Addgene plasmid #12259; http://n2t.net/addgene:12259; RRID:Addgene 12259), pRSV-Rev (Addgene plasmid #12253 ...
-
bioRxiv - Molecular Biology 2023Quote: Plasmids pSpCas9(BB)-2A-Puro (PX459) and pCMV-VSVG plasmid (pMD2.G) were kind gifts from Feng Zhang15 (Addgene plasmid #62988 ...
-
bioRxiv - Cell Biology 2023Quote: ... The lentiviral vectors were co-transfected into 293T cells with the packaging vectors pCMV-dR8.2 dvpr and pCMV-VSV-G (Addgene). Virus-infected cells were selected with 2 μg/ml puromycin ...
-
bioRxiv - Microbiology 2023Quote: 4e5 VeroE6 cells were plated in 6-well plates and transfected with 1 μg VSV-G plasmid (Addgene #8454) via TransIT-X2 (Mirus) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and lentiviral packaging vectors (pMD2.G Addgene plasmid #12259, 0.05 μg /reaction; and psPAX2, 0.50 μg /reaction Addgene #12260) using 6 μl LipofectamineTM 2000 (Thermo Fischer Scientific 11668019 ...
-
bioRxiv - Cancer Biology 2022Quote: ... HEK293-FT cells at 70% confluence were co-transfected with the plasmid of interest (0.50 μg DNA/ reaction) and lentiviral packaging vectors (pMD2.G Addgene plasmid #12259 ...
-
bioRxiv - Cancer Biology 2023Quote: Lentiviral particles were produced in HEK293T cells using psPax2 and pMD2.g second-generation packaging plasmids (Addgene #12260, #12259) with jetPRIME Polyplus transfection reagent ...
-
bioRxiv - Cancer Biology 2023Quote: ... and env-expressing plasmids (pMD2.G and psPAX) using the calcium-phosphate method.30 pMD2.G (Addgene plasmid #12259; http://n2t.net/addgene:12259; RRID: Addgene_12259) and psPAX2 (Addgene plasmid #12260 ...
-
bioRxiv - Bioengineering 2023Quote: ... followed by addition of the plasmid cocktail containing 4 µg of pMD2.G (a gift from Didier Trono; Addgene plasmid # 12259 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviral particles were generated by co-transfecting LentiGuide-sgRNA constructs and packaging constructs (psPAX2, RRID:Addgene_12260; and pMD2.G, RRID:Addgene_12259) to 293T cells ...
-
bioRxiv - Genomics 2024Quote: Lentivirus was produced from transfected HEK293T cells with packaging vectors (pMD2.G #12259, Addgene, and pCMV-dR8.91, Trono Lab) following the manufacturers protocol (#MIR6605 ...
-
bioRxiv - Cancer Biology 2023Quote: ... lentiviral pSMAL-CellTag-V1 pooled library and its associated packing plasmids pCMV-dR8.2 dvpr and pCMV-VSV-G were obtained from Addgene, lentiviruses were produced by transfecting with HEK293T cells using X-tremeGENETM 9 DNA Transfection Reagent from Sigma-Aldrich ...
-
bioRxiv - Immunology 2023Quote: ... a 4-1BB costimulatory domain and the CAR construct utilized for animals R.301-304 additionally expressed EGFRt.23 CARs were encoded by an xHIV plasmid which was co-transfected with an HIV-1 Rev/Tat and VSV-G envelope plasmid (RRID:Addgene_138479) for lentiviral production as previously described.23
-
bioRxiv - Synthetic Biology 2023Quote: A second-generation lentiviral packaging plasmid (pCMV delta R8.2, #12263), and envelope plasmid (pMD2.G, #12259) were acquired from Addgene (pCMV delta R8.2 and pMD2.G were gifts from Didier Trono (Addgene plasmid # 12263 ...
-
bioRxiv - Cancer Biology 2023Quote: ... IL1R1 sgRNA was custom designed against IL1R1 promoter G-quadruplex (G4-motif B) and cloned in pX333 (Addgene 64073) backbone after replacing Cas9 with mCherry.
-
bioRxiv - Cell Biology 2023Quote: ... The 2nd generation lenti-viral packaging plasmid pCMV-VSV-G was a gift from Bob Weinberg (Addgene plasmid # 8454). The pHAGE2 lenti-viral transfer plasmid was a gift from Magnus A ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV-DJ-EF1α::CVS-G (Produced by Stanford University Neuroscience Gene Vector and Virus Core using Addgene, plasmid #67528), AAV-DJ-EF1-DIO-tdTomato (Stanford University Neuroscience Gene Vector and Virus Core ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lenti-U6BC-sgDbl/Cre vectors were transfected as a pool into 293T cells with pCMV-VSV-G (Addgene #8454) envelope plasmid and pCMV-dR8.2 dvpr (Addgene #8455 ...
-
bioRxiv - Immunology 2024Quote: Pseudo-lentiviral particles containing sCD177 construct were generated using 293T cells and packaging vectors pMD2.G and pCMV-dR8.74psPAX2 (Addgene). Pseudo-lentiviral particles were transduced into the FreeStyle 293-F cells (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and pCMV-VSV-G 24 (a gift from Bob Weinberg, Addgene plasmid # 8454; http://n2t.net/addgene:8454; RRID: Addgene_8454), into the HEK293T cells by using the TransIT-Lenti transfection reagent (Mirus Bio) ...
-
bioRxiv - Microbiology 2020Quote: ... and 3 µg of pCAGGS-S (SARS-CoV-2)(Catalog No. NR-52310: BEI Resources) or VSV-G (a gift from Tannishtha Reya (Addgene plasmid # 14888 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were transduced the next day with 1000 ng of plasmid DNA plus 250 ng pMD2.G (Cat# 12259, Addgene) and 750 ng psPax2 (Cat# 12260 ...
-
bioRxiv - Developmental Biology 2021Quote: ... were seeded in DMEM with 10% FBS and transfected with the lentivirus vectors along with pCMV-VSV-G (Addgene, 8454), pRSV-Rev (Addgene ...
-
bioRxiv - Immunology 2021Quote: ... Lentiviral particles were produced in 293T cells using pMD2.G and psPAX2 (from Didier Trono, Addgene plasmids #12259 and #12260), and pINDUCER-21 plasmids ...
-
bioRxiv - Cancer Biology 2020Quote: ... to co-transfect pBABE-puro or pBABE-puro.SLX4IP.3xFLAG with pCMV-VSV-G (at a ratio of 6:1, Addgene#8454) into GP2-293 cells (Clontech) ...
-
bioRxiv - Cell Biology 2022Quote: ... 5.25 μg of transfer plasmid (LentiGuide-Hygro with 10-target or 20-target mgRNA) was mixed with 0.75 μg of pMD2.G (Addgene #12259) and 1 μg of psPAX2 (Addgene #12260) ...
-
bioRxiv - Cancer Biology 2020Quote: ... modified to express human histone H2B tagged at the N-terminus with GFP (pLVX-myc-EmGFP-H2B) plus psPAX2 and pMD2.G (gifts from Didier Trono, Addgene) using 16.6 mM CaCl2 in DMEM supplemented with 10% Hyclone™ serum (GE Healthcare ...
-
bioRxiv - Bioengineering 2019Quote: Genetic engineering of the reporter gene system involved third-generation packaging and envelope-expression plasmids (pMDLg/pRRE, pRSV-Rev, and pMD2.G, Addgene plasmids ...
-
bioRxiv - Cancer Biology 2019Quote: ... Packaging 293T cells were transfected with SAMHD1 sgRNAs (CRISPR SAMHD1) or a non-targeting sgRNA control (Control) and helper vectors (pMD2.G and psPAX2; Addgene plasmid #s 12259 and 12260 respectively ...
-
bioRxiv - Cancer Biology 2020Quote: ... and lentiviral particles for sgRNA were produced in HEK293T cells by co-transfecting pLXsgRNA plasmid with pMD2.G (Addgene# 12259) and psPAX2 (Addgene #12260).(Supplementary table 2a ...
-
bioRxiv - Cell Biology 2021Quote: ... and pLKO.1 puro-based plasmid harboring the designed shRNA (pCMV-VSV-G and pLKO.1 puro were a gift from Bob Weinberg, Addgene plasmid #8454 ...
-
bioRxiv - Microbiology 2019Quote: ... full length VPA0226 was amplified using primers 3’ GATC AGATCT ATGATGAAAAAAACAATCACACTA 5’ and 5’ GATA GAATTC G GAAACGGTACTCGGCTAAGTTGTT 3’ and cloned in frame with GFP into the expression vector sfGFP-N1 (41) (Addgene) between BglII and EcoRI sites for the expression of C terminally tagged VPA0226 ...
-
bioRxiv - Microbiology 2020Quote: Pseudotyped lentivirus particles were generated by co-transfection of lentiviral plasmids (e.g. pBA439-Psp-miRFP and pLenti-CMVtight-PspCas13b-eGFP) with pCMV-VSV-G(STEWART, 2003) (Addgene #8454) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Cell Biology 2020Quote: ... The cloned vectors were packed into lentivirus using second-generation packaging plasmids (pMD2.G, Addgene #12259 and psPAX2, Addgene #12260). Briefly ...
-
bioRxiv - Cell Biology 2020Quote: ... The cloned vectors were packed into lentivirus using second-generation packaging plasmids (pMD2.G, Addgene #12259 and psPAX2, Addgene #12260). Briefly ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviral packaging plasmid psPAX2 and pMD2.G encoding the vesicular stomatitis virus glycoprotein were gifts from Didier Trono (Univ. of Geneva) and purchased from Addgene (http://n2t.net/addgene:12260 and http://n2t.net/addgene:12259 ...
-
bioRxiv - Microbiology 2022Quote: Retrovirus particles for transduction and stable cell generation were produced in HNE-1 cells following JetPrime transfection of expression plasmids (pBabe neo, pBabe-HA-LMP1 neo) and packaging plasmids pMD2.G (Addgene; number 12259 ...
-
bioRxiv - Immunology 2022Quote: ... Briefly, the pBOB-hACE2 or hDPP4 plasmid and lentiviral packaging plasmids (pMDL, pREV, and pVSV-G (Addgene #12251, #12253, #8454)) were co-transfected into HeLa cells using Lipofectamine 2000 reagent (ThermoFisher Scientific cat.# 11668019).
-
bioRxiv - Cancer Biology 2022Quote: ... we transfected HEK 293T/17 cells with different plasmids together with the packaging plasmids pMD2.G (Gift from Didier Trono (Addgene plasmid #12259 ...
-
bioRxiv - Cell Biology 2022Quote: ... or pHAGE plasmids for overexpression of SOX15 or control mCherry were cotransfected with packaging vectors (psPAX2 and pMD2.G; Addgene) into 293T cells using PEI methods ...
-
bioRxiv - Cancer Biology 2022Quote: ... and each plasmid was packaged separately in 293T cells via co-transfection with polyethylenimine alongside pCMV-VSV-G (Addgene #8454) envelope plasmid and pCMV-dR8.2 dvpr (Addgene #8455 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Recombinant retroviruses were produced by co-transfecting either the pMSCV-GFP or pMSCV-caNFATc1 vectors together with retroviral packing plasmids gag/pol and pVSV-G (Addgene) into Phoenix cells using Effectene Transfection Reagent (QIAGEN) ...
-
bioRxiv - Microbiology 2020Quote: ... as well as packaging vectors psPax2 and pMD2.G (kind gifts from from Didier Trono (Addgene plasmid #12259 and 12260).
-
bioRxiv - Neuroscience 2020Quote: ... or shRNA constructs in combination with the psPAX2 packaging and pCMV-VSV-G envelope plasmids (Addgene plasmid #12260 and #8454) using FuGene HD (Promega ...
-
bioRxiv - Microbiology 2021Quote: ... The library lentivirus was generated by co-transfection of the library plasmid mixture with two lentiviral packaging plasmids pR8.74 and pVSV-G (Addgene, 12259) as a proportion of 10:10:1 into HEK293T cells ...
-
bioRxiv - Immunology 2020Quote: ... Generation of shRNA IFIT1 cells: 293T cells were co-transfected with psPax2 and pMD2.G (Addgene plasmids #12260 and #12259), as well as pLKO.1 (50 ...
-
bioRxiv - Genomics 2022Quote: ... 12 μg of plasmid library was cotransfected with 9 μg psPAX2 and 3 μg pMD2.G (Addgene #12260 and #12259) into HEK293FT cells using 72 μl Lipofectamine 2000 (Life Technologies #11668019) ...