Labshake search
Citations for Addgene :
1551 - 1600 of 1668 citations for Penicillin G since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... with the shRNA vector and Virapower packaging plasmids (pMDLg/pRRE, Addgene #12251; pRSV-Rev, Addgene #12253; pMD2.G, Addgene #12259) according to manufacturer instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... ORFs of interest were overexpressed using second-generation lentiviral system that consisted of pCMV-VSV-G (Weinberg lab) envelope plasmid and PsPAX2 (Trono lab) packaging plasmid acquired from Addgene. HEK293t cells were transfected with plasmid DNA at a ratio of 5:4:1 transfer plasmid:envelope plasmid:packaging plasmid ...
-
bioRxiv - Neuroscience 2024Quote: ... 200 µg of pH GT1-ademo/dF6 helper and 70 µg of pGP-AAV-syn-jGCaMP7b-WPRE (Plasmid Number 104489, Addgene)56 and mix with 18 ml OptiMEM (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... the DNA mixture consisted in 20 μg of specific DNA and 10 μg each of psPax2 and pMD2.G plasmids (from Dr. Didier Trono, Addgene) and 250 mM CaCl2 (in a final volume of 500 ul ...
-
bioRxiv - Neuroscience 2024Quote: ... NPC were then transduced with a VSV-G-pseudotyped lentivirus (carrying pCW57.1 plasmid from Addgene # 41393 (gift from David Root) modified to include hNGN2 under the doxycycline promoter) ...
-
bioRxiv - Microbiology 2024Quote: ... Lentivirus were produced by transfection of 293T cells with pCMV-VSV-G (a gift from Bob Weinberg, Addgene plasmid #8454), psPAX2 (a gift from Didier Trono ...
-
bioRxiv - Cell Biology 2024Quote: ... The lentiviral vector lentiCRISPRv2 carrying both Cas9 enzyme and a gRNA transfected into HEK293T cells together with the packaging plasmids psPAX2 and pCMV-VSV-G (Addgene) at the ratio of 5:3:2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviral particles were generated by transfecting HEK 293T cells with 12 μg of pLJM1-mEGFP or pLJM1ALKBH5 plasmids with 6 μg of psPAX2 packaging plasmid and 2 μg of pMD2.G envelope plasmid (Addgene). The medium was replaced 16h after transfection ...
-
bioRxiv - Genomics 2024Quote: ... Lentivirus was produced in HEK293T cells co-expressing the shRNA plasmid together with psPAX2 packaging plasmid and pVSV-G envelope plasmid (Addgene). Virus was concentrated using Lenti-X Concentrator (Takara ...
-
bioRxiv - Cell Biology 2023Quote: ... to co- transfect HEK 293FT cells with plasmids containing the packaging gag/pol and envelope pCMV- 435VSV-G genes and either the pMRX-IB-HaloTag7-mGFP-KDEL (Addgene, 184904 ...
-
bioRxiv - Neuroscience 2021Quote: ... We applied our system to the SAD-B19 genome plasmid in which the G gene has been replaced by EGFP (cSPBN-4GFP, Addgene #5248715), targeting the barcode cassette to the 3’ UTR of EGFP adjacent to the viral polyadenylation sequence53 ...
-
bioRxiv - Physiology 2019Quote: ... pLKO.1 scrambled shRNA or Sirt4 shRNA was transfected in HEK293 T cells with packaging plasmids pMD2.G (Addgene plasmid # 12259) and psPAX2 (Addgene plasmid # 12260) ...
-
bioRxiv - Biophysics 2021Quote: ... were transfected in DMEM with 2 % (v/v) FBS with 12 μg of pHR-CMV-TetO2 construct vector alongside 11 μg envelope plasmid (pMD2.G; Addgene #12259) and 11 μg packaging plasmid (psPAX2 ...
-
bioRxiv - Cell Biology 2021Quote: ... Lentiviruses were produced by transfecting HEK-293T cells with the transfer lentiCRISPR v2 plasmids and packaging plasmids pLTR-G (Addgene, 17532) and pCD/NL-BH*DDD (Addgene ...
-
bioRxiv - Plant Biology 2021Quote: ... 1 μg plasmid/transformation for the gene of interest and 0.5 μg plasmid/transformation of transformation marker (pUbi_GUSplus, Addgene, encoding ß-Glucuronidase) was applied.
-
bioRxiv - Cancer Biology 2020Quote: The dCas9-KRAB constructs were transfected in 293T cells with the 2nd generation lentiviral packaging and envelope plasmids psPAX2 and pMD2.g (Addgene, USA), using CaCl2 2.5M (Sigma ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1.5 × 107 293T cells in 150Lmm tissue culture dishes were transfected with 18☐μg of each plasmid DNA along with 4.5 μg of pMD2.G (Addgene #12259) and 9 μg of psPAX2 packaging vectors (Addgene #12260 ...
-
bioRxiv - Cell Biology 2022Quote: ... the following packaging and envelop plasmids were added to all of the 10-cm dishes as well: psPAX2 (6 μg) and pMD2.G (0.75 μg, Addgene, catalog #: 12259). psPAX2 (Addgene plasmid # 12260 ...
-
bioRxiv - Microbiology 2021Quote: ... the mutant constructs were co-transfected with psPAX2 and also the VSVg plasmid pMD2.G (Addgene; courtesy of Dr Didier Trono) at a molar ratio of 2:1:1 to increase the infection rate ...
-
bioRxiv - Developmental Biology 2021Quote: Retrovirus for GFP labeling was produced from 293gp NIT-GFP packaging cells by transfection with pCMV-VSV-G plasmid (Addgene #8454). Viral particles with low titer of about 106 PFU/ml were used for infection ...
-
bioRxiv - Biochemistry 2020Quote: ... Lentiviral particles expressing the above proteins were produced by co-transfecting expression plasmids individually with a second generation lentiviral packaging construct psPAX2 (courtesy of Dr Didier Trono through NIH AIDS repository) and VSVG plasmid pMD2.G (Addgene#2259) in HEK293T cells (Life Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... transfections were performed using the the pLenti-CMV-DEST vectors together with the lentivirus envelope and package plasmids pMD2.G (Addgene, #12259) and psPAX2 (Addgene ...
-
bioRxiv - Cancer Biology 2020Quote: ... HEK293T cells were transfected with each TGF-β1 shRNA construct along with packaging vectors pMD2.G (0.5 μg) and psPAX2 (1.5 μg) (Addgene, Inc., Watertown, MA) using Jet Prime Reagent (Polyplus-transfection® ...
-
bioRxiv - Immunology 2020Quote: ... GTG ACT GGC CAA GCC GTA G) were synthesised according to Sanjana et al (28) and cloned into pSpCas9(BB)-2A-GFP (Addgene, #48138) following BbsI digestion ...
-
bioRxiv - Neuroscience 2019Quote: ... as described(Wickersham et al., 2015) but with the use of the vesicular stomatitis virus envelope expression plasmid pMD2.G (Addgene 12259) for all vectors except for LV-U-TVA950(B19G) ...
-
bioRxiv - Biochemistry 2021Quote: ... and ER lumen ([Ca2+]ER) were monitored using G-GECO1.1 (a gift from Robert Campbell from University of Alberta; Addgene plasmid #32445) (Zhao et al. ...
-
bioRxiv - Immunology 2021Quote: ... produced in HEK293FT cells transiently transfected with two packaging plasmids (psPAX2 and pMD2-G) and the lentiCRISPR v2 plasmid (Addgene #52961)11 containing a non-targeting (GGCATCTTAACTAATCGTCT ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were transfected with a combination of three plasmids: 5 μg of pMD2.G (gift from Didier Trono, Addgene plasmids #12259), 15 μg of psPAX2 (gift from Didier Trono ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids were then linearized with MluI and 2μg of plasmid was transfected into 5×105 HEK293 cells together with a plasmid encoding the T7 polymerase 63 (Addgene 65974) using calcium phosphate ...
-
bioRxiv - Cell Biology 2020Quote: Plasmids used for transfection include pEGFP-C1 (GenBank: U55763.1, Clonetech) and pcDNA3-EGFP-Rac1-Q61L (a gift from G. Bokoch, Addgene plasmid #12981) (Subauste et al. ...
-
bioRxiv - Microbiology 2022Quote: GFP and myc-tagged 14-3-3ε were generated as follows: a G-block containing the full-length 14-3-3ε protein (IDT) was cloned into pEGFP-C1 (Addgene #2487) using XhoI and BamHI restriction sites ...
-
bioRxiv - Cancer Biology 2022Quote: ... 293T cells were transfected with retroviral or lentiviral transfer plasmid and packaging vector (retrovirus: pCL-Eco, Addgene, 12371; lentivirus: psPAX2, Addgene, 12260 with VSVg envelop plasmid pMD2.G, Addgene, 12259) using Mirus TransIT-LT1 (Mirus ...
-
bioRxiv - Cancer Biology 2022Quote: ... Viral supernatants were prepared by transfection of HEK293T cells with the vector plasmids and packaging plasmids (psPAX2 Addgene 12259 and pMD2.G Addgene 12260). The transfection was performed with polyethylenimine (PEI MAX Transfection Grade Linear Polyethylenimine Hydrochloride ...
-
bioRxiv - Cancer Biology 2022Quote: ... The lenti-vectors expressing each pair of gRNAs targeting distal enhancers were packaged in 293T cells using pMD2.G (Addgene # 12259) and psPAX (Addgene # 12260) ...
-
bioRxiv - Genomics 2022Quote: ... Viral particles were produced by transient transfection of HEK293T cells with the library and packaging plasmids pMD2.G (Addgene no. 12259) as well as psPAX2 (Addgene no ...
-
bioRxiv - Microbiology 2022Quote: Lentiviral particles were generated by co-transfection of the expression constructs and 2nd generation packaging plasmids (psPAX2, Addgene#12260 & pMD2.G, Addgene#12259), using jetPEI DNA transfection reagent (Polyplus transfection ...
-
bioRxiv - Neuroscience 2023Quote: ... pLVX-UbC-rtTA-Htt-Q94-CFP vector was co-transfected in HEK293T cells using Lipofectamine2000 with packaging vectors pMD2.G (Addgene, #12259) and psPAX2 (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... Transfer lentiviral plasmids (2500 ng) were diluted in 200 µl serum-free medium together with 225 ng pCMV-VSV-G (Addgene #8454) and 2250 ng psPAX2 (Addgene #12260 ...
-
bioRxiv - Cancer Biology 2023Quote: Lentiviruses and retroviruses were produced by co-transfecting the transfer plasmids with pMD2.G (Addgene #12259, a gift from Didier Trono) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Cell Biology 2023Quote: ... The following day, cells were co-transfected (using Lipofectamine 3000 treatment, as described above) with pMD2.g (envelope plasmid, Addgene #12259), psPAX2 (packaging plasmid ...
-
bioRxiv - Cell Biology 2023Quote: Lentiviral particles were prepared in HEK293T cells using standard calcium-phosphate transfection of the lentivector with packaging plasmids pMD2.G (Trono lab, Addgene #12259) and pCMV-dR8.74 (Trono lab ...
-
bioRxiv - Cell Biology 2023Quote: ... Transfection was performed using 1100 ng of total DNA (500 ng transfer plasmid, 500 ng pCMVR8.74 Addgene plasmid # 22036, 100 ng pCMV-VSV-G Addgene plasmid # 8454) The day before transfection ...
-
bioRxiv - Microbiology 2023Quote: ... lentiviral particles pseudotyped with the VSV-G protein were produced by cotransfecting HEK293T cells in 10cm dishes with 5 mg pLentiCMVPuroDEST vector (Addgene, #17452), 2 mg VSV-G Env expression vector pMD2.G (Addgene #12259 ...
-
bioRxiv - Cancer Biology 2023Quote: ... pMD2.G was a gift from Didier Trono (Addgene plasmid # 12259; http://n2t.net/addgene:12259; RRID:Addgene_12259; accessed on 22 March 2021).
-
bioRxiv - Cell Biology 2023Quote: ... at roughly 80% confluency with 4.5μg of an equimolar mixture of three plasmids encoding the envelope and viral packaging components from the laboratory of Didier Trono (pMD2.G: Addgene 12259; pRSV-Rev: Addgene 12253; pMDLg/pRRE: Addgene 12251). 4.5μg of lentiviral donor plasmid was added to the mixture and incubated for 20 min with 10μL of polyethylenimine (PEI ...
-
bioRxiv - Neuroscience 2023Quote: ... The pSAD 11.G H2B:GFP was obtained by taking advantage of the pSAD 11.G F3 expression vector (kindly provided by M. Tripodi, Cambridge University, AddGene #32634). The nucleotide sequence encoding the histone H2B-tagged GFP was designed and ordered via GeneArts (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviral particles for cas9 and HSP90-alpha were produced using HEK293T cells by con-transfection of transgene plasmid and pMD2.G (Addgene# 12259) and psPAX2 (Addgene #12260) ...
-
bioRxiv - Microbiology 2023Quote: ... two 6-well plates of 293T cells were transfected with plasmid pools described above, lentivirus helper plasmids (BEI: NR-52517, NR-52519, NR-52518) and VSV-G expression plasmid (Addgene #204156). This produced a VSV-G pseudotyped lentivirus pool carrying mutagenised spike sequences in their genomes ...
-
bioRxiv - Genomics 2023Quote: ... Lentivirus containing the landing pad sequence was produced by co-transfecting 293T cells at ∼50% confluence with psVSV-G (Addgene #12259), psPAX2 (Addgene #12260) ...
-
Cas13d-mediated isoform-specific RNA knockdown with a unified computational and experimental toolboxbioRxiv - Genomics 2023Quote: Lentivirus was produced via transfection of library plasmid pool and appropriate packaging plasmids (psPAX2, Addgene #12260 and pMD2.G, Addgene #12259) using linear polyethylenimine MW25000 (Polysciences ...