Labshake search
Citations for Addgene :
1601 - 1650 of 2254 citations for Mouse Cell Surface Hyaluronidase CEMIP2 ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... The IRE-SunTag reporter was integrated in previously established HeLa cell line stably expressing scFv-GFP (Addgene plasmid: 104998) and NLS-stdMCP-stdHalo fusion protein (Addgene plasmid ...
-
bioRxiv - Genomics 2020Quote: ... Mutagenesis was performed via either an inducible Cas9-expressing OCI-AML3 cell line (Lenti-iCas9-neo vector; Addgene 85400) with lentiviral sgRNA expression (Addgene 70683) ...
-
bioRxiv - Genomics 2020Quote: ... Cas9 expressing human melanoma cell line 2686 was transduced with lentiviral particles produced as described above using expression plasmid pXPR_011 (Addgene #59702 ...
-
bioRxiv - Cell Biology 2020Quote: ... 400,000 cells were transiently co-transfected with 200 ng of each gRNA expression plasmid (cloned into Addgene plasmid #43860), 500 ng Cas9 expression plasmid (Addgene plasmid #43945) ...
-
bioRxiv - Cancer Biology 2020Quote: Human ATG5 knockout P3 and T98G GBM cell lines were generated by using LentiCRISPRv268 (purchased from Addgene, plasmid# 99573). Plasmids were transfected into 293T cells using BBS/CaCl2 to produce lentivirus ...
-
bioRxiv - Molecular Biology 2021Quote: ... stable Cas9 expression was induced by transducing FL83B cells with lentiCas9-Blast (Addgene, #52962-LV, gift from Feng Zhang) lentivirus at a multiplicity of infection (MOI ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human cells used for RNA sequencing were first integrated with Not1-linearized pBABE-neo-hTERT plasmid (Addgene plasmid # 1774) and selected with G418 ...
-
bioRxiv - Cell Biology 2021Quote: ... used for creating tetracycline-inducible cell lines were gifts from Eric Campeau (w762-1: Addgene plasmid #26434; http://n2t.net/addgene:26434; RRID: Addgene_26434 ...
-
bioRxiv - Cell Biology 2021Quote: ARPE-19 cells were transduced with the lentiviral vector pCW-Cas9 (a gift from Eric Lander & David Sabatini, Addgene plasmid # 50661 ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were transfected using Lipofectamine 2000 with plasmids encoding pEGFP-C2 SENP2 (gift from Mary Dasso, Addgene plasmid # 13382) and infected 24 h later ...
-
bioRxiv - Microbiology 2020Quote: All virus-like particles were generated in HEK293T cells via calcium phosphate transfection using packaging plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259) ...
-
bioRxiv - Cancer Biology 2020Quote: HEK293T cells were transfected with packaging plasmid psPAX2 and envelope plasmid pMD2.G (both gifts from Didier Trono, Addgene plasmid # 12260 ...
-
bioRxiv - Cancer Biology 2020Quote: MOLM-13-Cas9 cells were first transduced with a luciferase expressing cassette in Lenti-luciferase-P2A-Neo (Addgene #105621) vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 293 cells were seeded in 10-cm-diameter dishes and transfected with pCMV-dR8.2 dvpr (Addgene plasmid #8455), pCMV-VSV-G (Addgene plasmid #8454 ...
-
bioRxiv - Biophysics 2022Quote: Escherichia coli NiCo21 (DE3) competent cells were transformed with the plasmid encoding sumo-tag fused DiCas7-11 (Addgene: 172503). A single colony was picked and transferred to 100mL LB media containing 50 μg/mL ampicillin and grown for 12 hours at 37°C before inoculation into 1L LB culture ...
-
bioRxiv - Cancer Biology 2022Quote: ... human umbilical vein endothelial cells (HUVECs) were infected with lentivirus constructs for CRISPR/Cas9 (Addgene plasmid #52961, lentiCRISPR v2) induced knock-out for Rbpj35 ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were seeded in 96-well plates and transfected 24h after with pMXs GFP-LC3-RFP (#117413, Addgene, MA) or with Polyinosinic-polycytidylic acid sodium salt ...
-
bioRxiv - Immunology 2022Quote: ... cells were transfected with 1.0 μg of pLV-PTB or pLV-CTRL with 0.8 μg psPAX2 (Addgene plasmid 12260) and 0.2 μg of pCI-VSVG (Addgene plasmid 1733 ...
-
bioRxiv - Cancer Biology 2022Quote: ... HEK293T cells (Dharmacon) were transfected with the Ass1 targeting lentiCRISPRv2 vectors and the lentiviral packing plasmids psPAX2 (Addgene: #12260) and pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... T98GEmpty and T98GcGAS cell lines were stably transfected with sfGFP-N1 (gift from Michael Davidson & Geoffrey Waldo; Addgene #54737) using phosphate calcium ...
-
bioRxiv - Cancer Biology 2022Quote: ... The PDE6D scan library contains 116 unique sgRNA was packaged by HEK293 cells (ATCC) co-transfected with psPAX2 (Addgene) and pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: HEK293 T-REx SNAPf-GLP-1R cells were co-transfected with an AP2-HA plasmid (μ2-HA-WT; Addgene plasmid # 32752 ...
-
bioRxiv - Cancer Biology 2020Quote: ... HEK293T cells were transfected with the relevant vectors and the second-generation packaging plasmids ΔR8.2 and Vsv-G (Addgene). Virus-containing supernatants were collected 48 h later and added with Polybrene to AML cells pre-seeded at ∼5 × 105/well in 24-well plates (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2021Quote: ... These pLKO.1 constructions were transfected in the 293T packaging cell line along with pMD2.G and pCMV-dR8.91 vectors (Addgene), following a typical Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: ... A549-ACE2-TMPRSS2 and Huh7-TMPRSS2 stable cell lines were generated using commercial lentivirus (Addgene, catalog no. 154982-LV) and selected using 10 μg/ml blasticidin (InvivoGen ...
-
bioRxiv - Cancer Biology 2022Quote: Polyclonal SK-N-DZ cells constitutively expressing the CRISPR activation machinery were engineered by transducing wild-type cells with lentiviral particles carrying a dCas9-VP64 (lenti dCas9VP64_Blast, Addgene plasmid #61425 was a gift from Feng Zhang ...
-
bioRxiv - Cancer Biology 2022Quote: ... and the resulting pQCXIN-PD-L1-IRES-Thy1.1 plasmid was transfected into HEK293T cells along with pCMV-VSV-G (a gift from Bob Weinberg; Addgene plasmid 8454 ...
-
bioRxiv - Molecular Biology 2021Quote: The cell cycle reporter vector pCSII-EF-miRFP709-hCdt(1/100) was a kind gift from Vladislav Verkhusha (Addgene plasmid # 80007 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Lentiviral particles were produced in 293T HEK cells by co-transfection of the lentiviral pCW57.1_Gata6 plasmid with VSV-G (pMD2.G, Addgene #12259) and helper plasmid (psPAX2 ...
-
bioRxiv - Biochemistry 2021Quote: ... HEK293T cells were transfected with plasmid encoding eSpCas9(1.1) and sgRNAs targeting CCT5 and ATP1A1 (modified from Addgene #86613) along with linear dsDNAs to act as HDR templates by which to insert 3xFLAG/Spytag at the C-terminus of CCT5 ...
-
bioRxiv - Biochemistry 2021Quote: ... we transfected HEK293T cells with Cas9 and sgRNA targeting the gene encoding for the CCT5 subunit (Addgene eSpCas9(1.1) vector ...
-
bioRxiv - Genetics 2020Quote: ... We generated cell lines expressing KRAB-dCas9-IRES-BFP under the control of a doxycycline-inducible promoter (Addgene #85449) and the reverse tetracycline transactivator (rtTA ...
-
bioRxiv - Cell Biology 2020Quote: ... the LoxStopLox cassette was removed by transfecting the cells with LV-Cre (from Inder Verma via Addgene, plasmid # 12106) using the previously described transfection protocol ...
-
bioRxiv - Cell Biology 2020Quote: The plasmid carrying Cas9/sgRNA was co-transfected into HEK293FT cells with the lentiviral packaging vectors psPAX2 (Addgene #12260) and VSV-g (Addgene #8454 ...
-
bioRxiv - Immunology 2021Quote: ... Virus was harvested from GP-2 cells transfected with SINV vectors and VSV-G (pMD2.G, Addgene plasmid #12259) and grown in DMEM supplemented with 30% FBS and 2mM glutamine ...
-
bioRxiv - Cancer Biology 2021Quote: ... the adherent cell cultures were cultured in the presence of lentiviral particles containing ΔLTR flanked CMV:tdTomato-blasticidin (Addgene#106173) and 8µg/mL polybrene (Sigma ...
-
bioRxiv - Systems Biology 2022Quote: ... or 1-2 x 105 cells/mL for pCL040-based inducible protein expression vectors (to be deposited on Addgene) to account for differences in infection efficiency ...
-
bioRxiv - Microbiology 2023Quote: ... Lentiviral packaging was carried out in HEK293T cells using the 3rd generation packaging plasmids pCMV delat R8.2 (#12263; Addgene) and pCMV-VSVG (#8454 ...
-
bioRxiv - Developmental Biology 2023Quote: ... viral lenti-particles were generated by transfecting HEK293 cells in a T25 flask with 15 μg of the lentiviral WβS-reporter vector (7TGC; Addgene #24304 ...
-
bioRxiv - Biochemistry 2023Quote: ... cells with pKS18 and the lentiviral packaging vectors pMD2.G (Addgene plasmid #12259; http://n2t.net/addgene:12259; RRID:Addgene 12259), pRSV-Rev (Addgene plasmid #12253 ...
-
bioRxiv - Cell Biology 2023Quote: ... Gene knockdown was performed in a sub-clonal K562 cell line stably expressing dCas9-KRAB-BFP (Addgene plasmid #102244), generously provided by Eric J ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transiently transfected with Cas9 and single guide RNAs plasmids with EGFP expression (PX458; Addgene plasmid no. 48138). The single guide RNAs targeting CDK6 and CDK4 (sequences TTAGATCGCGATGCACTACT and ATCTCGGTGAACGATGCAAT respectively ...
-
bioRxiv - Cell Biology 2023Quote: Whole-genome CRISPR screens were performed in U2OS and U2OSp53KO cells using the GeCKOv2 two-vector system (Addgene, #1000000049). The two pooled DNA half-libraries (A and B ...
-
bioRxiv - Cell Biology 2023Quote: ... The lentiviral vectors were co-transfected into 293T cells with the packaging vectors pCMV-dR8.2 dvpr and pCMV-VSV-G (Addgene). Virus-infected cells were selected with 2 μg/ml puromycin ...
-
bioRxiv - Microbiology 2023Quote: 4e5 VeroE6 cells were plated in 6-well plates and transfected with 1 μg VSV-G plasmid (Addgene #8454) via TransIT-X2 (Mirus) ...
-
bioRxiv - Genomics 2023Quote: ... Cells were transfected with each DNMT3B or GFP-only construct in addition to pCMV-dR8.2 dvpr (Addgene, plasmid #8455) and pCMV VSV-G (Addgene ...
-
bioRxiv - Immunology 2023Quote: ... Retrovirus were produced by transfecting HEK 293T cells with a mixture of PD-L1-pMIT1.1 (or PD-L2-pMIT1.1) and pCL-Eco (Addgene #12371) using Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... pseudovirus constructs (PV) have been developed by three-plasmid co-transfection in HEK293 cells using lentiviral backbone (Addgene # 8455), firefly luciferase reporter (Addgene #170674 ...
-
bioRxiv - Immunology 2024Quote: Pseudo-lentiviral particles containing sCD177 construct were generated using 293T cells and packaging vectors pMD2.G and pCMV-dR8.74psPAX2 (Addgene). Pseudo-lentiviral particles were transduced into the FreeStyle 293-F cells (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... Lentiviruses containing shRNA or sgRNA were produced using 293FT cells with packaging constructs pCMV-VSVG and pCMV-Delta 8.2 (Addgene). The lentiviruses were collected 48 hrs post transfection and concentrated by ultracentrifugation at 25,000 rpm for 2 hrs ...