Labshake search
Citations for Addgene :
1551 - 1600 of 2254 citations for Mouse Cell Surface Hyaluronidase CEMIP2 ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... we measured intramitochondrial free Ca2+ levels by transfecting AML12 cells with the CMV-mito-GEM-GECO1 plasmid (Addgene, 32461 ...
-
bioRxiv - Bioengineering 2023Quote: ... Lentiviruses were packaged using 293FT cells by co-transfection of lentiviral transfer plasmids with pMD2.G (Addgene #12259) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Cancer Biology 2023Quote: ... MCF7 CRISPRi were prepared by transduction of MCF7 cells with lentiviral particles produced using vector pMH0001 (Addgene #85969) in the presence of 8 mg/mL polybrene (Sigma) ...
-
bioRxiv - Cancer Biology 2023Quote: ... MCF7 cells were first transduced with lentiviral particles produced using vector pHRdSV40-dCas9-10xGCN4_v4-P2A-BFP (Addgene #60903) in the presence of 8 mg/mL polybrene ...
-
bioRxiv - Cancer Biology 2023Quote: ... Ifngr2−/− and Etv4−/− KPAR cell lines were generated by transient transfection of a Cas9-sgRNA plasmid (pX459, Addgene) generated by standard molecular cloning techniques (see Supplementary Table 3) ...
-
bioRxiv - Biophysics 2023Quote: ... 37] was used to generate the α-catenin DVBS in α-catenin KO cell line (Addgene plasmid 178649).
-
bioRxiv - Microbiology 2023Quote: ... we rescued lentiviral particles by co-transfecting 293T cells with the MKRN2 lentiviral vector alongside d8.74 (Addgene; 22036) and MD2G (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmid encoding NPM1-mEGFP was a gift from the Allen Institute for Cell Science (Addgene plasmid # 109122). The sgRNA was synthesized by Synthego with modifications using the protospacer sequence UCCAGGCUAUUCAAGAUCUC (Wienert ...
-
bioRxiv - Molecular Biology 2022Quote: ... or CALU6 and H1975 cells were infected with a metabolism focused CRISPR library (Addgene,(Birsoy et al., 2015)) ensuring a multiplicity of infection ∼0.3 following 3 days puromycin selection ...
-
bioRxiv - Cancer Biology 2022Quote: ... A2058-dCas9-KRAB cell lines were infected with Stress and Proteostasis-human subpooled sgRNA library (Cat#83973, Addgene), with MOI=0.3 and selected with puromycin (2 μg/mL ...
-
bioRxiv - Developmental Biology 2022Quote: Lentiviruses were produced in HEK 293T cells by cotransfection of lentiviral constructs with third generation packaging plasmids (Addgene) for 48–72 hr ...
-
bioRxiv - Cell Biology 2022Quote: ... YAP–HaloTag CRISPR knock-in U-2 OS cells were transfected with pEGFP-C3-Lats1 (Addgene plasmid # 19053) or pEGFP C3-Mst2 (Addgene plasmid # 19056) ...
-
bioRxiv - Microbiology 2022Quote: ... HEK293T cells were used to package lentiviruses by co-transfecting viral packaging plasmids pCMV-VSV-G (Addgene #8454), psPAX2 (Addgene #12260 ...
-
bioRxiv - Molecular Biology 2023Quote: ... which had been produced in HEK293T cells by transiently co-transfecting the lentiviral packaging plasmid psPAX2 (Addgene #12260), a lentiviral vector encoding μ-OR-SmBiT (pLenti-Blast Addgene #17451) ...
-
bioRxiv - Microbiology 2023Quote: The drug selection cassettes in the CN cell line were excised using transient expression of Cre recombinase from pLEW100Cre_del_tetO (Addgene plasmid 24019 ...
-
bioRxiv - Molecular Biology 2023Quote: ... MEFs cells were infected with a pLKO.1-Puro plasmid encoding a scrambled shRNA sequence (Addgene plasmid #1864). A list of the shRNA sequences is provided in Supplementary Table 2.
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were transfected using 30 μg of pMSCV-loxP-dsRed-loxP-eGFP-Puro-WPRE plasmid (Addgene, Plasmid #32702) or pMSCV-loxP-dsRed-loxP-Cited2-3HA-Puro-WPRE plasmid (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: KEAP1-sg1 knockout H1299 (4 x 105) cells were transfected with or without plasmid expressing Halo-KEAP1 (Addgene, a gift from Yimon Aye ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentivirus was produced in 293 cells by co-transfecting the lentiviral constructs with pCMV-dR8.2 (Addgene plasmid #8455) and pCMV-VSV-G (Addgene plasmid #8454 ...
-
bioRxiv - Immunology 2023Quote: ... DC 2.4 cells were transduced using the lentiCas9-Blast vector (Addgene plasmid # 52962; http://n2t.net/addgene:52962; RRID: Addgene_52962) and selected with 10 ug/mL of Blasticidin (AG Scientific #3513-03-9) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... HEK293T cells were co-transfected with lenti-EF1a-dCas9-KRAB-Puro plasmid (a gift from Kristen Brennand; Addgene_99372) or pLV-dCas9-p300-P2A-PuroR plasmid (a gift from Charles Gersbach ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells (2.5 x 105) were plated in a 6-well plate and transfected with pLenti-BLRR (Addgene # 158958), pLenti-trGluc (Addgene # 158959) ...
-
bioRxiv - Neuroscience 2024Quote: ... 6 × 107 RPE1 cells were infected with the human sgRNA library (Human GeCKO v2 Library Cat#1000000048, Addgene) at an MOI of ∼0.3 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 293T cells were plated in 10cm plates and transfected using lipofectamine 2000 with 6μg lentiviral pCW57.1-4EBP1_4xAla (Addgene: 38240), 1.5μg pMD2G and 4.5μg psPax2 ...
-
bioRxiv - Molecular Biology 2024Quote: Non-replicating lentiviruses were produced in HEK293T cells using the 2nd generation packaging plasmids psPAX2 construct (Addgene #12260), pMD2.G construct (Addgene #12259) ...
-
bioRxiv - Molecular Biology 2024Quote: ... HEK293T cells were transfected with landing pad plasmid (pHPHS232) and pASHS29 (AAVS1 T2 CRISPR in pX330108/Addgene 72833) using polyethylenimine ...
-
bioRxiv - Neuroscience 2024Quote: ... the cells were transfected with a plasmid coding for human STIM1 fused with YFP (Addgene, plasmid no. 19754) 3 days before experiments ...
-
bioRxiv - Microbiology 2024Quote: ... lentiviruses encoding sgRNAs were generated by transient transfection of 293T cells with packaging plasmids pasPAX2 (Addgene, Plasmid #12260) and pCMV-VSV-G (Addgene ...
-
bioRxiv - Biochemistry 2024Quote: ... cells were transfected 24h after seeding with mammalian expression plasmids to visualize Golgi (EYFP-Golgi7, Addgene plasmids # 56590), using JetPRIME transfection reagent (Polyplus transfection ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were transfected with a mixture of 1.7 μg attB plasmid + 0.2 μg pCAG-NLS-Bxb1 (Addgene#51271) + 0.2 μg pMAX-GFP + 7.8 μL Fugene 6 (for LLP lines ...
-
bioRxiv - Microbiology 2024Quote: ... Approximately 200 million K562-Cas9-Blast cells were transduced with each GeCKOv2 library A or B [46] (Addgene #1000000048 or #1000000049 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were then collected and electroporated with an sgRNA and Cas9 expression plasmid (pX330-LMNA-gRNA1, Addgene #122507) and an mClover donor plasmid (pCR2.1 Clover-LMNA Donor ...
-
bioRxiv - Neuroscience 2024Quote: ... Cells seeded in 35 mm glass bottom dishes (60% confluent) were transfected with pGP-CMV-GCaMP6f (Addgene#40755) using PEI Max (Polysciences ...
-
bioRxiv - Genomics 2024Quote: Lentivirus was produced by HEK-293FT cells which were co-transfected with lentiviral packaging plasmid psPAX275 (Addgene 12260), lentiviral enveloping plasmid pMD2.G (Addgene 12259 ...
-
bioRxiv - Developmental Biology 2024Quote: CCNC was depleted in the HeLa and HCT116 cell lines by dually transfecting CRISPR Cas12a plasmids (pTE4398, Addgene) containing gRNA directed to Exon 1 and Exon 2 (pSW496 and pSW497 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviruses containing shRNA or sgRNA were produced using 293FT cells with packaging constructs pCMV-VSV-G (Addgene, #8454) and pCMV-Delta R8.2 (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: Transduction of AML cell lines was performed as described above using pMRX-IP-GFP-LC3-RFP (Addgene #84573)59 ...
-
bioRxiv - Bioengineering 2024Quote: Lentiviral vectors were produced in HEK 293T cells upon transfection with a packaging plasmid (psPAX2; Addgene plasmid 12260), an envelope plasmid (pCMV-VSVG-G ...
-
bioRxiv - Cell Biology 2024Quote: MCF10A-LifeAct-GFP cells were produced by transduction of MCF10A cells with lentiviral particles generated in HEK293T after transient transfection of pLenti.PGK.LifeAct-GFP.W (Addgene, #51010) using Lipofectamine 3000 (ThermoFisher ...
-
bioRxiv - Cancer Biology 2024Quote: CHLA-20 and SH-SY5Y cells were co-transduced with lentiviruses carrying the dCas9-VP64_blast (Addgene, Cat#61425) and lenti MS2-p65-HSF1_hygro (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... viral particles were generated by transfecting Platinum-E ecotropic packaging cell line with retroviral vectors (pLPC-puro; RRID:Addgene_19835) encoding Xenopus Rad18 using Lipofectamine® reagent (Invitrogen) ...
-
bioRxiv - Neuroscience 2024Quote: ... polyA_R, Table 3) and plasmid backbone (Col1E_F, Col1E_R, Table 4) were amplified from pPRISM-Stop-cmlc2-eGFP (Addgene kit #1000000154; Wierson et al., 2020). The PCR-amplified fragments were assembled using NEBuilder HiFi DNA Assembly Cloning Kit (E5520S ...
-
bioRxiv - Cancer Biology 2021Quote: SPRY2 CRISPR oligonucleotides used in H1299 cells (gRNA target site: GTACTCATTGGTGTTTCGGA) were cloned into pSpCas9(BB)-2A-Puro (Addgene plasmid #62988 ...
-
bioRxiv - Cell Biology 2020Quote: ... a cell line stably expressing Cas9 was generated by infection with lentiCas9-Blast (Addgene 52962, gift from Feng Zhang) and selection with blasticidin ...
-
bioRxiv - Immunology 2022Quote: ... To subclone the fusion protein constructs GFPNKG2D-S/L into the retroviral stem cell vector pMIGR1 (Addgene, plasmid 27490), forward 5’ TAGTAGGAATTCGCCACCATGAGCGGGGGCGAGGAC 3’ and the reverse 5’ TAGAGGTCGACCTTACACCGCCCTTTTCATGCAG3’ primers were used ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293 cells were transfected with 4µg pSMPUW-IRIS-Neo-H2BmRFP (Fachinetti Lab) + 4µg pMD2.G (12259 from Addgene, RRID:Addgene_12259) + 4µg psPAX2 (12260 from Addgene ...
-
bioRxiv - Microbiology 2022Quote: ... ACE2-expressing lentivectors were generated via transient co-transfection of HEK293T cells with RRL.sin.cPPT.SFFV/Ace2.IRES-puro (Addgene Plasmid #145839), psPAX2 and VSV-G ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were transfected with the addressing and packaging plasmids (pCMV delta R8.2, Addgene #12263; pCMV-VSV-G, Addgene #8454). After 48 hours of expression ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were transfected with the addressing and packaging plasmids (pCMV delta R8.2, Addgene #12263; pCMV-VSV-G, Addgene #8454). After 48 hours of expression ...
-
bioRxiv - Molecular Biology 2020Quote: ... These parental BV2 or BV2-Cas9 cells were transduced for 2 d with pXPR_011 lentivirus expressing eGFP (Addgene; 59702) and an sgRNA targeting eGFP at a multiplicity of infection (MOI ...