Labshake search
Citations for Addgene :
1251 - 1300 of 2354 citations for Primary Human Aortic Endothelial Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... purified from bacteria cells transformed with the plasmid pET-28b-RfxCas13d-His (Addgene 141322), was kindly provided by JP Concordet ...
-
bioRxiv - Genomics 2023Quote: K562 CRISPRi cells were transduced with the hCRISPRi-v2 top 5 library (Addgene #83969)138 with 840X representation ...
-
bioRxiv - Genetics 2023Quote: ... 293T cells were transfected with the plasmids pCMVR8.74 (a gift from Didier Trono (Addgene plasmid #22036 ...
-
Astroglia proliferate upon biogenesis of tunneling nanotubes and clearance of α-synuclein toxicitiesbioRxiv - Cell Biology 2023Quote: One population of U-87 MG cells were transiently transfected with pLV-mitoDsRed (Addgene #44386 ...
-
bioRxiv - Neuroscience 2023Quote: ... At DIV0 cells were infected with either AAV-Cre-GFP-hSyn (Addgene, 105540-AAV9) or AAV-GFP (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... and PEI transfected into HEK293T cells along with pUMVC retroviral packaging construct (Addgene # 8449) and VSVG envelope construct (Addgene #8454) ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... carbenicillin/ampicillin resistance was introduced into NA22 competent cells using pUC1975 (Addgene, product #50005) to generate strain PXKR1 ...
-
bioRxiv - Cell Biology 2023Quote: The producer cell line HEK 293TN was transfected with the packaging (psPAX2, Addgene 12260), envelope (pMD2.G ...
-
bioRxiv - Cell Biology 2022Quote: ... After 24 h cells were co-transfected with 1.3 pmol of psPAX2 (Addgene, 12260), 0.72 pmol pCMV-VSV-G (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: MiaPaCa2 cells were transfected with the bicistronic pcDNA3-RLUC-POLIRES-FLUC plasmid (Addgene 45642) (55 ...
-
bioRxiv - Cancer Biology 2023Quote: ... GBM cells (G411) were transduced with lentiviral vector pBMN (CMV-copGFP-Luc2-Puro, Addgene plasmid #80389 ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293 cells were transfected with pFlagCMV2-14-3-3sigma (Addgene, Cambridge, MA, Plasmid #12453) (68) ...
-
bioRxiv - Cell Biology 2023Quote: ... a stable cell line was created using pLV-Stargazin-mTurquoise2-iLID (Addgene Plasmid #161001) (54 ...
-
bioRxiv - Cell Biology 2023Quote: CRISPR mediated knock-outs were performed by transducing HEK293 cells with LentiCRISPRV2 (Addgene #52961) lentivirus expressing sgRNAs targeting genes of interest (FASTKD5_sg1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and pLenti-PGK-Neo-PIP-FUCCI (Fluorescent Ubiquitination-based Cell Cycle Indicator) (Addgene # 118616) was used for accurate cell cycle phase indicator [34] ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were then transfected with 1 μg of pHrD-IRES-Fluc (Addgene plasmid #194250) and 1 ng of CMV-Rluc reporter plasmids (78 ...
-
bioRxiv - Synthetic Biology 2024Quote: Phagemid-containing supernatants were added to 2.5 mL S2060 cells (streptomycin-resistant, Addgene #105064) grown to OD600 = 0.5 and allowed to infect at 37 °C and 250 rpm for 1 h ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were transfected 24h before the imaging with Str-Ii_VSVG-SBP-EGFP (Addgene #65300). Live imaging was performed with a spinning disk microscope for 45 min and one frame was acquired every 30 sec ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Cells were transiently transfected with 1 μg of each plasmid expressing GCaMP6s (Addgene #277314.1040753) (Chen et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... mitochondria were labelled in cells by transduction with pLV-mitoDsRed virus (Addgene, Plasmid 44386) harvested post expression in 293-FT cells and lentiviral particle production ...
-
bioRxiv - Genomics 2023Quote: HaCat dCas9-VPR cells were produced using Lenti-EF1a-dCas9-VPR-puro (Addgene #99373). HaCat dCas9-KRAB-MeCP2 cells were produced using a custom pLV-CBh-dCas9-KRAB-MeCP2- T2A-Puro synthesised by VectorBuilder.
-
bioRxiv - Cell Biology 2024Quote: ... PEX3 KO or PEX19 KO cells were co- transfected with pMD2.G (Addgene, 12259), psPAX2 (Addgene,12260 ...
-
bioRxiv - Cell Biology 2023Quote: ... The GIGYF1-KO A549 cells were generated using Lenti-Cas9-Blast (Addgene, plasmid 52962) and pLenti-CRISPRv2 (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 x 106 HEK293T cells were co-transfected with 5μg psPAX2 (Addgene, Plasmid # 12260), 5μg pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293T cells were transfected with the lentiviral vector pLenti-PGK-ER-KRASG12V (Addgene, 35635) and the packaging plasmids pCMV-VSV-G (Addgene ...
-
bioRxiv - Genetics 2023Quote: ... K562 cells were stably transduced with the pHR-SFFV-dCas9-BFP-KRAB cassette (Addgene plasmid #46911 ...
-
bioRxiv - Microbiology 2023Quote: 293TN cells were transfected with the lentiviral envelope and packaging plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Molecular Biology 2024Quote: ... MutuI cells were transduced with lentiparticles derived from pCW-Cas9-Blast (Addgene Plasmid #83481) and selected for stable integration with 10 μg/mL blasticidin ...
-
bioRxiv - Cell Biology 2024Quote: ... AICSDP-82:SON-mEGFP was a gift from Allen Institute for Cell Science (Addgene plasmid # 133964 ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were transduced with lentivirus generated from the PIP-FUCCI plasmid (Addgene plasmid #138715) as described above ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were also stably transfected with GFP-CD63 and mCherry-CD81 plasmids (Addgene, USA) for exosomal tracking ...
-
bioRxiv - Cancer Biology 2023Quote: ... The cells were sequentially transduced with lentiviruses of the lentiCRISPR-Puro (Addgene plasmid #52961) expressing Tp53 sgRNA (CCTCGAGCTCCCTCTGAGCC ...
-
bioRxiv - Cancer Biology 2024Quote: H1299 cells were engineered with stable Cas9 expression using Lenti-Cas9-blast (Addgene #52962). Efficient nuclease activity was confirmed using a reporter system (Addgene #67979 ...
-
bioRxiv - Cancer Biology 2024Quote: HT29 cells previously infected with pLenti-U6-tdTomatato-P2A-BlasR (LRT2B) virus (Addgene, 1108545) that enables dual production of firefly luciferase and TdTomato were used ...
-
bioRxiv - Cell Biology 2024Quote: CRISPR-based knockout cell lines were generated using the lentiCRISPRv2 vector obtained from Addgene, which expresses a single guide RNA ...
-
bioRxiv - Cell Biology 2024Quote: ... Both Flox and iKO cells were transfected with 600ng of tfLC3 plasmid (Addgene, 21704) using Lipofectamine LTX (Invitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... HEK293T cells were co-transfected with the second-generation packaging plasmid psPAX2 (Addgene #12260), envelope plasmid VSV-G (Addgene #12259 ...
-
bioRxiv - Biophysics 2023Quote: ... HEK293T cells were co-transfected with the second-generation packaging plasmid psPAX2 (Addgene #12260), envelope plasmid VSV-G (Addgene #12259 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Trp53- conditional LUAD cells were stably transfected with vectors pLUC (Cag.Luc.puro, Addgene ID 74409, RRID:Addgene_74409) or with vectors encoding CRE recombinase pCRE (pPy-CAG- Cre::ERT2-IRES-BSD ...
-
bioRxiv - Cancer Biology 2021Quote: ... Trp53- conditional LUAD cells were stably transfected with vectors pLUC (Cag.Luc.puro, Addgene ID 74409, RRID:Addgene_74409) or with vectors encoding CRE recombinase pCRE (pPy-CAG- Cre::ERT2-IRES-BSD ...
-
bioRxiv - Cell Biology 2021Quote: ... then cells were transfected with 9 µg of each of pMXs-Oct4 (Addgene Plasmid #13366), pMXs-Sox2 (Addgene Plasmid #13367) ...
-
bioRxiv - Molecular Biology 2021Quote: ... BJ EHLT were obtained by retroiviral transduction of BJ cells with hTERT (Addgene plasmid #1773) and Large T SV40 antigen (Addgene plasmid # 21826 ...
-
bioRxiv - Cancer Biology 2022Quote: ... was co-transfected into 80% confluent lenti-X 293T cells with 4.8 μg psPAX2 (Addgene) and 3.2 μg pMD2.G (Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: ... HEK293T cells were transfected with the transfer vector and the packaging plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259) ...
-
bioRxiv - Neuroscience 2021Quote: HeLa cells were plated on glass coverslips and transfected with PSD95-tRFP (Plasmid #52671, Addgene) and/or EGFP-tagged SynGAP C-terminal constructs (EGFP-CCα1 or EGFP-CCPBM plasmids (made in house ...
-
bioRxiv - Molecular Biology 2021Quote: ... Lentivirus was produced in HEK293T cells using a 2nd generation lentiviral packaging system (psPAX2 – Addgene plasmid #12260 and pMD2.G – Addgene #12259 from Didier Trono ...
-
bioRxiv - Microbiology 2019Quote: ... Cells were transfected with intracellular markers for the plasma membrane (LCK-GFP; Addgene plasmid #61099), endoplasmic reticulum (pLV-ER GFP ...
-
bioRxiv - Immunology 2019Quote: ... We transfected constructs into HEK293T cells along with lentivirus packaging vector pSPAX2 (Addgene plasmid #12260) and lentivirus envelope vector VSV-G (Addgene plasmid #8454) ...
-
bioRxiv - Cell Biology 2019Quote: ... DHPC-018 cells were infected at passage 20 with lentivirus expressing FUGW-eGFP (Addgene, #14883), then sorted on a FACS Aria II cell sorter for GFP fluorescence ...
-
bioRxiv - Cell Biology 2019Quote: HeLa cells were co-transfected with plasmid encoding mCherry-tagged Parkin (31) (Addgene plasmid #23956;) and encoding either ABCB-ChR2-YFP or ABCB-YFP using the Neon Transfection System (Invitrogen ...