Labshake search
Citations for Addgene :
9351 - 9400 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: Two different versions of the Brunello library were used – a “1 vector system” (backbone expresses both Cas9 and the sgRNA library – Addgene #73179) and a “2 vector system” (backbone expresses only the sgRNA library – Addgene #73178) ...
-
bioRxiv - Genomics 2023Quote: SW480 cells were also transduced with lentiCRISPR v2 (Addgene #52961) and with Lenti-Cas9-2A-Blast (Addgene #73310 ...
-
bioRxiv - Bioengineering 2023Quote: ... pCXLE-dCas9VP192-T2A-EGFP-shP53 (Addgene #69535), GG-EBNA-OSK2M2L1-PP (Addgene #102898 ...
-
bioRxiv - Genomics 2023Quote: ... and with Lenti-Cas9-2A-Blast (Addgene #73310) at approximately 60% confluence in the presence of polybrene (8 μg/mL) ...
-
bioRxiv - Genomics 2023Quote: sgRNAs targeting 3 different locations in the genome were cloned into a modified version of pU6-sgRNA EF1Alpha-puro-T2A-BFP (Addgene, #60955), where BFP was replaced by superfolder GFP (sfGFP ...
-
bioRxiv - Genomics 2023Quote: SW480 cells were transduced with Lenti-iCas9-neo (Addgene #85400) at approximately 60% confluence in the presence of polybrene (8 μg/mL) ...
-
bioRxiv - Genomics 2023Quote: ... A375 and HEK293T cells were transduced with lentiCas9-EGFP (Addgene #63592) at approximately 40-60% confluence in the presence of polybrene (8 μg/mL) ...
-
bioRxiv - Bioengineering 2023Quote: ... the Cas6-p300 plasmid (Addgene #106275) was digested with BamHI and then MSN and NMS domains were cloned in using NEBuilder HiFi DNA Assembly ...
-
bioRxiv - Bioengineering 2023Quote: ... MCP-p65-HSF1 (Addgene #61423), scFv-VP64 (Addgene #60904) ...
-
bioRxiv - Immunology 2023Quote: ... 293T cells were co-transfected with equal amounts of this plasmid and pCas9_GFP32 (a gift from Kiran Musunuru, Addgene plasmid # 44719). GFP-positive cells were sorted after 48 hours on a MoFlo cell sorter (Beckman Coulter) ...
-
bioRxiv - Neuroscience 2023Quote: ... oligos encoding guide RNAs targeting intron 2 and intron 3 of murine Dyrk1a were cloned into plasmid pX459 v2.0 (Addgene plasmid # 62988) and sequence verified ...
-
bioRxiv - Biophysics 2023Quote: ... The gRNA sequence (GCGGCCGGGCTCCATGGCGC) was cloned into pSpCas9(BB)-2A-GFP (Addgene, PX458; deposited by Dr. Feng Zhang). The replacement DNA was designed to contain 700 bps of the homologous region for both sides of the inserted mEos2 sequence ...
-
Neural mechanisms underlying uninstructed orofacial movements during reward-based learning behaviorsbioRxiv - Neuroscience 2023Quote: ... or AAV9-Ef1a-mCherry (Addgene # 114470 ...
-
Neural mechanisms underlying uninstructed orofacial movements during reward-based learning behaviorsbioRxiv - Neuroscience 2023Quote: ... or AAV9-Ef1a-mCherry (Addgene # 114470, obtained from Addgene; the original titer ...
-
bioRxiv - Neuroscience 2023Quote: ... or left IC (0.9 mm caudal and 1 mm lateral from lambda suture) to inject 100-200 nL of pAAV-Syn-Chronos-GFP virus (Addgene #59170-AAV1). At the end of the surgery ...
-
bioRxiv - Cell Biology 2023Quote: Lysosome localisation signal (residues 27 to 407 of Human LAMP1) was extracted by PCR from Addgene’s plasmid #55308 ...
-
bioRxiv - Microbiology 2023Quote: ... psPAX2 (Addgene #12260 ...
-
bioRxiv - Genomics 2023Quote: ... pT444T (Addgene plasmid # 113081; Sturm et al. 2018). RNAi bacteria were grown overnight in LB media with 1000 ug/mL ampicillin and diluted to a relative OD600 of 2.5 before seeding ...
-
bioRxiv - Genomics 2023Quote: AAV production was performed by transfecting 293FT cells with 22 ug of pDGM6 helper plasmid (Addgene plasmid # 110660), 6 ug of donor template plasmid ...
-
bioRxiv - Genomics 2023Quote: Plasmids in the pCAG backbone used to overexpress TWIST1 and ALX4 in HEK293 cells were cloned by digesting the pCAG-NLS-HA-Bxb1 plasmid (Addgene plasmid # 51271) prepared from dam-/dcm- E ...
-
bioRxiv - Neuroscience 2023Quote: The lentiviral vector LV-TTBL(VSVG) was made as described (Wickersham et al., 2015) using the genome plasmid pLV-TTBL (Jin et al., 2021) (Addgene 115233) and using the VSV envelope expression plasmid pMD2.G (Addgene 12259 ...
-
bioRxiv - Microbiology 2023Quote: ... We first generated a CRISPRi cell line by transducing J-Lat A72 with the vector lenti-EF1a-dCas9-KRAB-Puro (Addgene #99372, a gift from Kristen Brennand). After selecting with puromycin-containing media (1 μg/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... virus or a AAV5-EF1a-DIO-hChR2(H134R)-eYFP (4.2×1012 vg/mL, UNC GTC Vector core, USA, RRID:Addgene_35507) control virus were injected with the same protocol as above to infect the entire mesencephalon of Syt1+/+ and Syt1-/- mice ...
-
bioRxiv - Genomics 2023Quote: ... Digested plasmid to co-express a gRNA and Cas9 with a puromycin resistance cassette (pX459; Addgene) was purified from a 1% agarose gel using a Gel and PCR Clean-up Kit (Macherey-Nagel ...
-
bioRxiv - Genomics 2023Quote: ... and a “2 vector system” (backbone expresses only the sgRNA library – Addgene #73178). In this study we also used our Essential/Safe-havens library described above.
-
bioRxiv - Genomics 2023Quote: ... with flanking sequences to enable PCR amplification and Gibson assembly into lentiGuide-Puro (pLG, Addgene #52963). The pooled oligo library was amplified using pLG_U6_foward 5’- GGCTTTATATATCTTGTGGAAAGGACGAAACACCG-3’ and pLG-TRACR_reverse 5’-GACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3’ ...
-
bioRxiv - Systems Biology 2023Quote: ... additional control plasmids (PA-NL, Addgene #113445; PA-mCit-NL, Addgene #113444; PA-mCit, Addgene #113443; NL, Addgene #113442) were used ...
-
bioRxiv - Molecular Biology 2023Quote: ... pHR-FUSN-mCh-Cry2WT (Addgene #101223), and MCP-YFP (Addgene #101160 ...
-
bioRxiv - Neuroscience 2023Quote: ... The human CRISPR Knockout library was a gift from Michael Bassik (Addgene #101927). In brief ...
-
bioRxiv - Neuroscience 2023Quote: ... A 10-sgRNA-per-gene CRISPR/Cas9 deletion library (Human CRISPR Knockout library was a gift from Michael Bassik (Addgene # 101926-101934)) was infected into Cas9-expressing U937 cells as described16 ...
-
bioRxiv - Neuroscience 2023Quote: ... digested with BamHI/HindIII and cloned to the BamHI/HindIII digested pGP-AAV-syn-jGCaMP8s (Plasmid #162374 Addgene).
-
bioRxiv - Neuroscience 2023Quote: ... AAV8-hSyn-DIO-hM4D(Gi)-mCherry22 (Addgene 44362-AAV8) and AAV8-FREX-ChR2-EYFP (gift from Henning Fenselau ...
-
bioRxiv - Neuroscience 2023Quote: ... The FPs td-tomato-C1 (plasmid #54653 Addgene) and eGFP (kindly provided by Prof ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/1-DIO-EF1α-mKate2-biPAC (Boston Children’s Hospital Vector Core; Addgene 169127), AAV2/1-EF1a-DIO-mKate2-PDE4D3-Cat (Boston Children’s Hospital Vector Core ...
-
bioRxiv - Neuroscience 2023Quote: ... Male PV-Cre and both male and female Ai6 mice were secured in a stereotaxic frame and bilateral injections of 200-300 nl AAV1 virus vectors (AAV1-EF1a-DIO-ChETA-eYFP (Addgene: 26968) to PV-Cre mice and pENN-AAV1-hSyn-Cre-WPRE-hGH (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... The pLKO-TRC plasmid was a gift from David Root (Addgene plasmid #10879, http://n2t.net/addgene:10879; RRID:Addgene_10879) (38) ...
-
bioRxiv - Systems Biology 2023Quote: We obtained the AsCas12a crRNA expression vector directly from Addgene (pRG232, Addgene_149723)60 ...
-
bioRxiv - Systems Biology 2023Quote: ... and plasmids will be available from Addgene. Other reagents and protocols are available upon request.
-
bioRxiv - Synthetic Biology 2023Quote: ... and pTKEI-Dest (Addgene #79784). The following modifications were made to the plasmids from Nadler et al ...
-
bioRxiv - Neuroscience 2023Quote: ... we injected rAAV5-Syn-Flex-GCaMP6f-WPRE-SV40 (Addgene 100833) in the right hemisphere wS1 of Emx1-IRES-Cre mice (in mm relative to Bregma ...
-
bioRxiv - Synthetic Biology 2023Quote: ... All plasmids are available from Addgene (pEF1-Phyper-spank-sfGFP ...
-
bioRxiv - Synthetic Biology 2023Quote: ... psPAX2 (Addgene plasmid #12260, a gift from D. Trono), and pCMV-VSV-G-RSV-Rev (RIKEN BioResource Research Center plasmid RDB04393 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... a gift from David Waugh (Addgene plasmid # 8827; http://n2t.net/addgene:8827; RRID: Addgene_8827). The desired ERS strength was encoded onto the primers used to amplify the protease genes ...
-
bioRxiv - Synthetic Biology 2023Quote: Plasmid pJL1-sfGFP was purchased from Addgene (cat. 69496). All the expression plasmids to construct One Pot protein factors were purchased through Addgene (cat ...
-
bioRxiv - Developmental Biology 2023Quote: ... and cloned into the pGL3-U6-2sgRNA-ccdB-EF1a-Cas9ZF-IRES (Addgene, Plasmid#115519) vector ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2A-mCherry-loxP-Neo-loxP fragment was cloned from Nanog-2A-mCherry plasmid (Addgene # 59995). The different fragments were then cloned to a modified pUC19 plasmid with additional restriction sites inserted ...
-
bioRxiv - Immunology 2023Quote: ... AAVS constructs were transfected into hESCs along with LentiCRISPRv2-mCherry (Addgene plasmid 99154), encoding a gRNA for human AAVS1 targeting (GGAAGAGAGTAGGTCGAAG ...
-
bioRxiv - Molecular Biology 2023Quote: ... Dox-inducible GFP-HMGB1mut U2OS cells were generated using a previously described pPB-TetON-mEGFP-HMGB1-MUT PiggyBac transposon (Addgene #194562)39 ...
-
bioRxiv - Molecular Biology 2023Quote: ... We subcloned the Tn5 transposase (from Addgene plasmid #60240) and purified the enzyme for DNA tagmentation97,98 ...
-
bioRxiv - Cell Biology 2023Quote: ... psPAX2 (packaging plasmid, Addgene #12260, a gift from Didier Trono) and lentiCRISPRv2-puro (transfer plasmid ...