Labshake search
Citations for Addgene :
9251 - 9300 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 1/10th mass BirA (Addgene plasmid 20857), and 50 µM D-biotin at 30 °C for 1 h ...
-
bioRxiv - Microbiology 2023Quote: ... mKO2 was PCR amplified from the template mKO2-N1 (Addgene, Cat. #4625) using primers containing matching restriction sites ...
-
bioRxiv - Microbiology 2023Quote: ... J-Lat A72 CRISPRi cells were transduced with the lentiviral vector pLKO5.sgRNA.EFS.tRFP (Addgene #57823, a gift from Benjamin Ebert), containing target-specific sgRNAs (J-Lat A72 CRISPRi CD73KD ...
-
bioRxiv - Neuroscience 2023Quote: ... 200 nl of AAV2-retro-hSyn-Cre (2.39E+13 gc/ml from Addgene) or RVΔL-5Cre(B19G ...
-
bioRxiv - Neuroscience 2023Quote: ... was made by cloning the TRE-tight element from pAAV-TREtight-mTagBFP2-B19G (Liu et al., 2017) and the EGFP gene into pB-CAG-TEVp-IRES-mCherry (Addgene 174377) in place of the CAG-TEVp-IRES-mCherry sequences using HiFi seamless cloning (NEB).
-
Neural mechanisms underlying uninstructed orofacial movements during reward-based learning behaviorsbioRxiv - Neuroscience 2023Quote: ... or AAV9-Ef1a-DIO-EYFP (Addgene #27056, obtained from Addgene; the original titer ...
-
Neural mechanisms underlying uninstructed orofacial movements during reward-based learning behaviorsbioRxiv - Neuroscience 2023Quote: ... AAV9-CaMKIIa-hChR(E123T/T159C)-mCherry (Addgene #35512 ...
-
bioRxiv - Neuroscience 2023Quote: ... craniotomy was performed and an AAV virus (AAV9-CamKIIa-ChrimsonR-mScarlet-Kv2.1, which was a gift from Christopher Harvey via Addgene.org by63 was injected with a glass capillary using a stereotaxic robot (Neurostar GmbH ...
-
bioRxiv - Molecular Biology 2023Quote: ... The following plasmids were a gift from Paul Khavari (Addgene plasmid #107253; #107252; #107250. http://n2t.net/addgene: 50917; 107252; 107250. RRID: Addgene_50917; Addgene 107252; Addgene 107250) (Ramanathan et al. ...
-
bioRxiv - Molecular Biology 2023Quote: pDONR207 SARS-CoV-2 NSP1 was a gift from Fritz Roth (Addgene plasmid # 141255 ...
-
bioRxiv - Cell Biology 2023Quote: ... The following plasmids were both gifts from Michael Nick Boddy and bought from Addgene: pFA6a-KanMX-tetO-pCyc1 (TetP ...
-
bioRxiv - Systems Biology 2023Quote: ... The BsmBI-flanked spacer was then replaced by a fragment amplified from pJR98 (Addgene #140096), carrying the constant region of the first sgRNA and the promoter for the second one ...
-
bioRxiv - Systems Biology 2023Quote: ... We used a lentiviral backbone (pJR101, a variant of pJR85, Addgene #140095 ...
-
bioRxiv - Systems Biology 2023Quote: The CRISPRi Calu-3 cell line was generated by lentiviral delivery of pMH0001 (UCOE-SFFV-dCas9-BFP-KRAB) (19) (Addgene #85969) into Calu-3 cells ...
-
bioRxiv - Neuroscience 2023Quote: ... was packaged by Vector Biolabs using a plasmid from Addgene (#118273). AAV encoding Cre-dependent TdTomato (AAV9.CAG.FLEX.TdTomato ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV encoding Cre-dependent TdTomato (AAV9.CAG.FLEX.TdTomato) was purchased from Addgene (#51503). Titers of the GCaMP6f and TdTomato viruses were 1×1012 and 1.9×1013 GC/mL ...
-
bioRxiv - Neuroscience 2023Quote: The viral construct AAV5-EF1a-DIO-hChR2(H134R)-eYFP-WPRE-HGHpA (Titer=2.1×1013 GC/mL) was obtained from Addgene (#20298). Male and female SST-IRES-Cre+/- mice at least 8 weeks old were deeply anesthetized with 5% isoflurane and underwent stereotaxic surgery ...
-
bioRxiv - Neuroscience 2023Quote: First CaMPARI coding sequence was PCR amplified from plasmid pcDNA3-CaMPARI (gift from Loren Looger & Eric Schreiter, Addgene plasmid #60421) (Fosque et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... myrGFP from pJFRC19-13XLexAop2-IVS-myr::GFP (gift from Gerald Rubin, Addgene #26224) (Pfeiffer et al. ...
-
bioRxiv - Physiology 2023Quote: ... and AAV-hSYN-Laconic (Laconic: Addgene #44238) was constructed by the viral vector facility of ETH Zurich ...
-
bioRxiv - Physiology 2023Quote: ... IκBα and NFKB1 gene sgRNA was cloned into LentiCRISPRv2 plasmid (Addgene) as previously described(54 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and pMD2.G (Addgene, plasmid # 12259), gifts from Didier Trono ...
-
bioRxiv - Cancer Biology 2023Quote: ... BRCA1 was amplified from pDEST-mCherry-LacR-BRCA1 (Addgene, plasmid #71115), and BRCA2 was amplified from pCIN BRCA2 WT (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... pBA439 was a gift from Jonathan Weissman (Addgene, plasmid # 85967)19 ...
-
bioRxiv - Neuroscience 2023Quote: ... was made by replacing the mCre gene in pRVΔGL-4Cre (Chatterjee et al., 2018) (Addgene 98039) with the SAD B19 glycoprotein gene from pCAG-B19G (Chatterjee et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... amino acids 1220-1711) of 53BP1 from TP53BP1 cDNA (a gift from Anthony Davis) and cloned into a pBABE-zeo construct (Addgene). DLD-1 cells engineered to carry the dCas9-SunTag system and expressing H2B-mCherry were transduced with retroviruses that were packaged in 293GP cells for 24 hours and selected with 50 μg/mL zeocin for two weeks ...
-
bioRxiv - Cell Biology 2023Quote: ... CDC42 WT (12599) and DN (12601) plasmids were obtained from Addgene [23] ...
-
bioRxiv - Cell Biology 2023Quote: The plasmid pFA6a-GFP(S65T)-His3MX6 (Longtine et al., 1998) was a gift from John Pringle (Addgene 41598; Addgene, Watertown, MA) and pFA6a-link-yoTagRFP-T-Kan (Lee et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... and pFA6a-link-yoTagRFP-T-Kan (Lee et al., 2013) was a gift from Wendell Lim & Kurt Thorn (Addgene 44906); both were given in the form of bacterial stabs ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV1-Syn-GCaMP6f-WPRE-SV40 (titer: 2.8 × 10^13 GC/mL) was purchased from AddGene and was diluted 1:4 in sterile 1× PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... pFA6a-KanMX-tetO-pCyc1 (TetP) (Addgene plasmid # 41023 ...
-
bioRxiv - Molecular Biology 2023Quote: Constructs expressing artificial circRNAs of different sizes are based on the pcDNA3.1(+) Laccase2 MCS Exon Vector (Addgene 69893). We inserted a perfectly matched or seed-mutant site for miR-92a using the NotI and ApaI sites located between the Laccase2 intron and the poly(A ...
-
bioRxiv - Systems Biology 2023Quote: ... The Mobile-CRISPRi plasmid pJMP2748 is a variant of pJMP2754 (Addgene 160666) with the sgRNA promoter derived from pJMP2367 (Addgene 160076 ...
-
bioRxiv - Molecular Biology 2023Quote: ... or pcDNA-hWnt16-V5 (Addgene 35942) plasmid respectively ...
-
bioRxiv - Molecular Biology 2023Quote: ... pMD2.G and psPax2 (Addgene plasmids #12259 and #12260 ...
-
bioRxiv - Physiology 2023Quote: FLAG-IKK2 kinase inactive K44M (IKK2DN, Addgene, #15466) was cloned into pLenti-CMV-Puro DEST vector (Addgene ...
-
bioRxiv - Plant Biology 2023Quote: ... Guide RNA targeting a unique region of OsCLSY3 gene at 1st exon (UCCUCUCGGCCCUCCAACAG) was cloned into pRGEB32 vector (Addgene Plasmid #63142) (Xie and Yang ...
-
bioRxiv - Cell Biology 2023Quote: ... mCherry-tagged CLIMP63 (gift from Gia Voeltz 52, Addgene, 136293),mcherry-FIS1 (gift from Uri Manor53) ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transiently transfected with mCherry (gift from Michael Davidson, Addgene, 54517), mCherry-tagged CLIMP63 (gift from Gia Voeltz 52 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and pCMVR8.74 expressing the gag/pol genes (Addgene plasmid 22036). The supernatants containing the viral particles were collected 48–72 h after transfection ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were co-transfected using the PEI method with the lentiviral expression vector and two 2nd generation lentiviral packaging vectors: pMD2.G expressing the VSV-G envelope gene (Addgene plasmid 12259) and pCMVR8.74 expressing the gag/pol genes (Addgene plasmid 22036) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The linear transcript used as a negative control consists of GFP expressed from pRRLSIN.cPPT.PGK-GFP.WPRE (Addgene plasmid 12252).
-
bioRxiv - Molecular Biology 2023Quote: ... from the Syn promoter (pLV-FLAG-HA_AGO2) was generated by amplifying FLAG/HA-AGO2 from pIRESneo-FLAG/HA AGO2 (Addgene plasmid 10822).
-
bioRxiv - Neuroscience 2023Quote: ... AAV2-CAG-GFP (50 µL, 1.5 x 1013 GC/mL, Addgene 37825-AAV2) was injected intravitreally 4 mm posterior to the temporal aspect of the limbus ...
-
bioRxiv - Genetics 2023Quote: ... and pZCS41 (Addgene ID 193050), are available through Addgene and can be freely viewed and edited in ApE (Davis and Jorgensen ...
-
bioRxiv - Genetics 2023Quote: ... the hsp16.41 promoter was amplified from pMA122 (Addgene ID34873) (Frøkjær-Jensen et al. ...
-
bioRxiv - Genetics 2023Quote: ... Plasmids pDSP15 (Addgene ID 193853), pDSP16 (Addgene ID193854) ...
-
bioRxiv - Neuroscience 2023Quote: ... and 200 nl of AAV1-CaMKII-GCaMP6f (Addgene, Catalog #100834-AAV1) was microinfused into the PrL cortex (AP ...
-
bioRxiv - Neuroscience 2023Quote: ... Both vectors were being transfected and packaged into lentiviral particles through using the packaging vectors psPAX2 lentiviral packaging vector (Addgene, 12260) and pMD2.G lentiviral packaging vector (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV-hSyn-hM4D(Gi)-mCherry was a gift from Bryan Roth (Addgene plasmid # 50475 ...