Labshake search

9151 - 9200 of 10000+ citations since 2019

• Structural basis for inhibition of mycobacterial ATP synthase by squaramides and second generation diarylquinolines

  Gautier M. Courbon, et al., bioRxiv - Biochemistry 2023

  Quote: ... smegmatis mc2 155 pTEC27 (Takaki et al., 2013) (a gift from Dr. Lalita Ramakrishnan: Addgene plasmid #30182 ...
• SUMO interacting motif (SIM) of S100A1 is critical for S100A1 post-translational protein stability

  Zegeye H. Jebessa, et al., bioRxiv - Biochemistry 2023

  Quote: WT S100A1 and its variants were synthesized (Eurofins MWG) and cloned into the pAdTrack-CMV plasmid (#16405, Addgene) (Table S1) ...
• A Methylation-Phosphorylation Switch Controls EZH2 Stability and Hematopoiesis

  Pengfei Guo, et al., bioRxiv - Biochemistry 2023

  Quote: ... human EZH2 wildtype and the K20R or S21A mutant of human EZH2 were cloned into the retroviral pMSCV-Puro vector containing 3xFlag-3xHA epitope (Addgene) and the recombinant retroviruses were packaged in 293 cells (Guo et al. ...
• A general strategy to develop fluorogenic polymethine dyes for bioimaging

  Annabell Martin, Pablo Rivera-Fuentes, bioRxiv - Biochemistry 2023

  Quote: pET24b-6His-fSNAP (Addgene #106999) was transformed into E ...
• A general strategy to develop fluorogenic polymethine dyes for bioimaging

  Annabell Martin, Pablo Rivera-Fuentes, bioRxiv - Biochemistry 2023

  Quote: ... and pmTurquoise2-Golgi (Addgene #36205) were used ...
• A general strategy to develop fluorogenic polymethine dyes for bioimaging

  Annabell Martin, Pablo Rivera-Fuentes, bioRxiv - Biochemistry 2023

  Quote: ... the plasmids pmTurquoise2-ER (Addgene #36204) and pmTurquoise2-Golgi (Addgene #36205 ...
• A general strategy to develop fluorogenic polymethine dyes for bioimaging

  Annabell Martin, Pablo Rivera-Fuentes, bioRxiv - Biochemistry 2023

  Quote: ... DNA encoding SNAPf or H2B-SNAPf was amplified from pSNAPf-H2B control plasmid (Addgene #101124) to generate an insert ...
• Structure of a Membrane Tethering Complex Incorporating Multiple SNAREs

  Kevin A. DAmico, et al., bioRxiv - Biochemistry 2023

  Quote: ... N-terminal or C-terminal heptahistidine (His7) tags were added using pQLinkH (Addgene plasmid 13667) or a modified derivative ...
• Structure of a Membrane Tethering Complex Incorporating Multiple SNAREs

  Kevin A. DAmico, et al., bioRxiv - Biochemistry 2023

  Quote: ... we used pQLinkN (Addgene plasmid 13670). The Dsl1:Qb:Qc complex was overproduced using a single concatenated pQLink plasmid bearing genes encoding His7-Dsl1 ...
• Mechanistic insights into the UFM1 E3 ligase complex in ufmylation and ribosome-associated protein quality control

  Ryosuke Ishimura, et al., bioRxiv - Biochemistry 2023

  Quote: ... guide RNA was designed using the CRISPR Design tool (http://crispr.mit.edu/) and subcloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene #42230), a human codon-optimized SpCas9 and chimeric guide RNA expression plasmid ...
• Mechanisms of transcription control by distal enhancers from high-resolution single-gene imaging

  Lingling Cheng, et al., bioRxiv - Biophysics 2023

  Quote: ... a 24×MS2 cassette was cut from pCR4-24×MS2SL-stable (Addgene 31865) and pasted into pUC57-HA-L-T2A-HygR -HA-R ...
• Mechanisms of transcription control by distal enhancers from high-resolution single-gene imaging

  Lingling Cheng, et al., bioRxiv - Biophysics 2023

  Quote: ... oligo pairs were annealed and ligated into BbsI -digested espCas9 plasmid (Addgene 71814). For validating the efficiency of gRNAs ...
• Mechanisms of transcription control by distal enhancers from high-resolution single-gene imaging

  Lingling Cheng, et al., bioRxiv - Biophysics 2023

  Quote: ... several gRNAs were designed in the downstream region of Klf4 and cloned into pspCas9-2A-puro (PX459, Addgene 62988). Before the day of transfection ...
• The histone methyltransferase NSD3 contributes to sister chromatid cohesion and to cohesin loading at mitotic exit

  Grégory Eot-Houllier, et al., bioRxiv - Molecular Biology 2023

  Quote: ... A HeLa H2B-mCherry EmGFP-NSD3-L cell line was generated by transfecting EmGFP-NSD3-L cells with a pH2B_mCherry_IRES_puro2 plasmid (Addgene #21045) as described above ...
• The histone methyltransferase NSD3 contributes to sister chromatid cohesion and to cohesin loading at mitotic exit

  Grégory Eot-Houllier, et al., bioRxiv - Molecular Biology 2023

  Quote: A fragment containing an inducible TRE-tight promoter and a LAP tag (a FLAG-tag followed by an EmGFP-tag) was inserted at the XhoI site of the plasmid pBSKDB-CAG-rtTA2sM2-IRES-tSkid-IRES-Neo (Addgene #62346), thereby generating the vector pGEH_ind_LAP-C ...
• Activation of Nedd4L Ubiquitin Ligase by FCHO2-generated Membrane Curvature

  Yasuhisa Sakamoto, et al., bioRxiv - Cell Biology 2023

  Quote: ... pET21d-Ube1 was a gift from Cynthia Wolberger (Addgene plasmid # 34965; http://n2t.net/addgene:34965; RRID:Addgene_34965) (Berndsen & Wolberger ...
• Activation of Nedd4L Ubiquitin Ligase by FCHO2-generated Membrane Curvature

  Yasuhisa Sakamoto, et al., bioRxiv - Cell Biology 2023

  Quote: ... mTagRFP-T-Clathrin-15 was a gift from Michael Davidson (Addgene plasmid # 58005; http://n2t.net/addgene:58005; RRID:Addgene_58005) (Shaner et al ...
• Activation of Nedd4L Ubiquitin Ligase by FCHO2-generated Membrane Curvature

  Yasuhisa Sakamoto, et al., bioRxiv - Cell Biology 2023

  Quote: ... pRSET-mSA was a gift from Sheldon Park (Addgene plasmid # 39860 ...
• Comparative proximity biotinylation implicates RAB18 in sterol mobilization and biosynthesis

  Robert S. Kiss, et al., bioRxiv - Cell Biology 2023

  Quote: ... A construct encoding mCherry-ER was obtained from Addgene, and a construct encoding TMCO4-EGFP was synthesised and cloned by GeneWiz (Leipzig ...
• Comparative proximity biotinylation implicates RAB18 in sterol mobilization and biosynthesis

  Robert S. Kiss, et al., bioRxiv - Cell Biology 2023

  Quote: ... and used to generate constructs encoding mEmerald-RAB18 and mCherry-RAB18 by ligation into mEmerald-C1 and mCherry-C1 vectors (Addgene, Watertown, MA) using HC T4 Ligase and rapid ligation buffer (Promega ...
• Comparative proximity biotinylation implicates RAB18 in sterol mobilization and biosynthesis

  Robert S. Kiss, et al., bioRxiv - Cell Biology 2023

  Quote: ... Annealed oligonucleotides were diluted and ligated into BbsI-digested pX461 and pX462 plasmids (Addgene) using HC T4 Ligase and rapid ligation buffer (Promega) ...
• Epithelial galectin-3 induces mitochondrial complex inhibition and cell cycle arrest of CD8⁺ T Cells in severe/critical ill COVID-19

  Yudie Wang, et al., bioRxiv - Immunology 2023

  Quote: ... Packaging plasmid GAG and envelope plasmid VSV-G were obtained from Addgene, USA.
• DNMT3B PWWP mutations cause hypermethylation of heterochromatin

  Francesca Taglini, et al., bioRxiv - Genetics 2023

  Quote: ... To generate vectors for the protein stability assay DNMT3B and mutant sequences were cloned into pLenti-DsRed-IRES-EGFP (Addgene plasmid 92194, a gift from Huda Zoghbi).
• DNMT3B PWWP mutations cause hypermethylation of heterochromatin

  Francesca Taglini, et al., bioRxiv - Genetics 2023

  Quote: ... DNMT3 sequences from pcDNA3-Myc-DNMT3B2 and pcDNA3-Myc-DNMT3A1 plasmids (Addgene plasmids 36942 and 35521 ...
• DNMT3B PWWP mutations cause hypermethylation of heterochromatin

  Francesca Taglini, et al., bioRxiv - Genetics 2023

  Quote: ... and transfected with SNAP-DNMT3B plasmid in addition to HP1⍺-GFP plasmid (a gift from Tom Misteli, Addgene plasmid 17652). After 48 h cells were incubated for 30 min at 37 °C with SNAP-Cell 647-SiR substrate (NEB ...
• DNMT3B PWWP mutations cause hypermethylation of heterochromatin

  Francesca Taglini, et al., bioRxiv - Genetics 2023

  Quote: ... the CRISPR Targets track from the USCS genome browser (https://genome.ucsc.edu) was used for guide RNA design and the corresponding oligonucleotides cloned into pSpCas9(BB)-2A-GFP (pX458, Addgene Plasmid 48138, a gift of F. Zhang). The donor template for homology-directed repair was an 80 nt ss-oligo Alt-R HDR Donor Oligo (Integrated DNA Technologies ...
• Hemato-vascular specification requires arnt1 and arnt2 genes in zebrafish embryos

  Hailey E. Edwards, et al., bioRxiv - Developmental Biology 2023

  Quote: ... etsrp (gift of Dr. Nathan Lawson, Addgene plasmid # 49005) (Moore et al. ...
• Epithelial galectin-3 induces mitochondrial complex inhibition and cell cycle arrest of CD8⁺ T Cells in severe/critical ill COVID-19

  Yudie Wang, et al., bioRxiv - Immunology 2023

  Quote: ... and provided by Addgene, USA ...
• Inducible mismatch repair streamlines forward genetic approaches to target identification of cytotoxic small molecules

  Thu P Nguyen, et al., bioRxiv - Biochemistry 2023

  Quote: Guide RNA targeting PARP1 (5’- CCACCTCAACGTCAGGGTGC) was cloned into LentiCRISPRv2 vector (Addgene, 52961). Lentivirus carrying CRISPR/Cas9-PARP1 guide was transduced to HCT116 in the presence of 8 μg/ml polybrene ...
• Inducible mismatch repair streamlines forward genetic approaches to target identification of cytotoxic small molecules

  Thu P Nguyen, et al., bioRxiv - Biochemistry 2023

  Quote: Guide RNA targeting ATP6V1B2 (5’- AAACTTACCATCATTAGGCA) was cloned into pX330 vector (Addgene, #42230). HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tacatgtatacagatttagccacgatatatgaacgcgctgggcgagtggaagggagaaacggctcgattactcaaatccctattctGacAatgcctaatA atggtaagttttggtatttggattataacacacctaatcattttaaagagagagaagacccatctaccttttcgagttgaagttattttgagaacacatc using TransIT-LT (Mirus) ...
• Template-assisted covalent modification of DCAF16 underlies activity of BRD4 molecular glue degraders

  Yen-Der Li, et al., bioRxiv - Biochemistry 2023

  Quote: The following plasmids were used in this study: Cilantro (PGK.BsmBICloneSite.FlexibleLinker.eGFP.IRES.mCherry.cppt.EF1α.PuroR, Addgene 74450) for degradation characterization ...
• Inducible mismatch repair streamlines forward genetic approaches to target identification of cytotoxic small molecules

  Thu P Nguyen, et al., bioRxiv - Biochemistry 2023

  Quote: Guide RNA targeting PARP1 (5’- AAACATGTAGCCTGTCTGGA) was cloned into pX330 vector (Addgene, #42230). HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccagacaggctacatgtttggtaaagggatcta tttcactgatatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatcctgttgggagaagttgcccttggaaacatgtg agt for A898T mutation and 5’- tggcactcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccag acaggctacatgtttggtaaaggaatctgtttcgctgacatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatc ctgttgggagaagttgcccttggaaacat for Y896C mutation using TransIT-LT (Mirus) ...
• Inducible mismatch repair streamlines forward genetic approaches to target identification of cytotoxic small molecules

  Thu P Nguyen, et al., bioRxiv - Biochemistry 2023

  Quote: ... and 100 ng pMD2.G (Addgene, #12259) with TransIT-Lenti (Mirus ...
• Inducible mismatch repair streamlines forward genetic approaches to target identification of cytotoxic small molecules

  Thu P Nguyen, et al., bioRxiv - Biochemistry 2023

  Quote: ... 900 ng psPAX (Addgene, #12260), and 100 ng pMD2.G (Addgene ...
• Inducible mismatch repair streamlines forward genetic approaches to target identification of cytotoxic small molecules

  Thu P Nguyen, et al., bioRxiv - Biochemistry 2023

  Quote: Guide RNA targeting the genomic region surrounding MSH2 stop codon was cloned into pX330 (Addgene #42230). The repair template was constructed in a pGEM-T Easy vector to include 1 kilobase homology arms matching upstream and downstream sequences of the genomic locus ...
• Activation of Nedd4L Ubiquitin Ligase by FCHO2-generated Membrane Curvature

  Yasuhisa Sakamoto, et al., bioRxiv - Cell Biology 2023

  Quote: ... mTagRFP-T-Clathrin-15 was a gift from Michael Davidson (Addgene plasmid # 58005 ...
• Activation of Nedd4L Ubiquitin Ligase by FCHO2-generated Membrane Curvature

  Yasuhisa Sakamoto, et al., bioRxiv - Cell Biology 2023

  Quote: ... pET21d-Ube1 was a gift from Cynthia Wolberger (Addgene plasmid # 34965 ...
• A Synthetic, Closed-Looped Gene Circuit for the Autonomous Regulation of RUNX2 Activity during Chondrogenesis

  Gurcharan Kaur, et al., bioRxiv - Genetics 2023

  Quote: ... pINDUCER13 was acquired from Addgene (plasmid # 46936) for further modification as such a lentiviral vector conveniently contains a Tet-on inducible cassette that co-expresses luciferase and shRNA sequence as well as a cDNA sequence of a constitutively active puromycin resistance gene (Fig 3a) ...
• Functional gene delivery to and across brain vasculature of systemic AAVs with endothelial-specific tropism in rodents and broad tropism in primates

  Xinhong Chen, et al., bioRxiv - Bioengineering 2023

  Quote: ... The AAV capsid AAV1-X1 was built by inserting a 7-mer peptide between AAs 588-589 of the AAV1 cap gene in AAV1-Rep-Cap (Challis et al. 2019) (Addgene 112862).
• Functional gene delivery to and across brain vasculature of systemic AAVs with endothelial-specific tropism in rodents and broad tropism in primates

  Xinhong Chen, et al., bioRxiv - Bioengineering 2023

  Quote: ... pAAV:CAG-tdTomato (a gift from Edward Boyden, Addgene plasmid # 59462). To make pAAV:CAG-eGFP-3xMir122-TS (Addgene ID ...
• Functional gene delivery to and across brain vasculature of systemic AAVs with endothelial-specific tropism in rodents and broad tropism in primates

  Xinhong Chen, et al., bioRxiv - Bioengineering 2023

  Quote: ... The AAV-PHP.V1 capsid was described previously (Ravindra Kumar et al, 2020, Addgene 127847). The AAV capsid AAV-X1.1 (Addgene 196836 ...
• Functional gene delivery to and across brain vasculature of systemic AAVs with endothelial-specific tropism in rodents and broad tropism in primates

  Xinhong Chen, et al., bioRxiv - Bioengineering 2023

  Quote: ... To make pAAV:CAG-eGFP-3xMir122-TS (Addgene ID: will be deposited on Addgene), 3 copies of the Mir122-TS were cut out from plasmid CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS (Challis et al ...
• 3D Microcapsules for Human Bone Marrow Derived Mesenchymal Stem Cell Biomanufacturing in a Vertical-Wheel Bioreactor

  Matthew Teryek, et al., bioRxiv - Bioengineering 2023

  Quote: ... plasmid #12259 (Addgene), at a molar ratio of 3:2:1 ...
• Efficient gene activation in plants by the MoonTag programmable transcriptional activator

  J. Armando Casas-Mollano, et al., bioRxiv - Bioengineering 2023

  Quote: The dead Cas9 coding sequence (dCas9) including nuclear localization signals was obtained from pEG302 22aa SunTag VP64 nog (Addgene plasmid #120251). DNA fragments encoding different copy numbers of the GP41 peptide separated by a 5 amino acids GS linkers were derived from the plasmid 24×MoonTag-kif18b-24×PP7 (addgene plasmid #128604 ...
• Mitochondrial citrate metabolism and efflux regulates trophoblast differentiation

  Renee M. Mahr, et al., bioRxiv - Developmental Biology 2023

  Quote: ... and pMD2.G (Addgene plasma #12259) using Fugene transfection reagent (Promega ...
• Primate-conserved Carbonic Anhydrase IV and murine-restricted Ly6c1 are new targets for crossing the blood-brain barrier

  Timothy F. Shay, et al., bioRxiv - Bioengineering 2023

  Quote: ... and pAAV:CAG-2xNLS-EGFP (equivalent version with one NLS: Addgene ID: 104061), as noted in figures and legends ...
• Selection of Extended CRISPR RNAs with Enhanced Targeting and Specificity

  Ashley Herring-Nicholas, et al., bioRxiv - Bioengineering 2023

  Quote: ... pBbA2c-RFP was a gift from Jay Keasling (Addgene plasmid # 35326 ...
• Selection of Extended CRISPR RNAs with Enhanced Targeting and Specificity

  Ashley Herring-Nicholas, et al., bioRxiv - Bioengineering 2023

  Quote: ... the Cas9 gene was PCR amplified from pwtCas9-bacteria (Addgene #44250) and a gBlock (purchased from Integrated DNA Technologies [IDT] ...
• Selection of Extended CRISPR RNAs with Enhanced Targeting and Specificity

  Ashley Herring-Nicholas, et al., bioRxiv - Bioengineering 2023

  Quote: ... and pSECRETS-C (p11.LacY.wtx1 plasmid (Addgene #69056) high copy pBR322 ori ...
• Selection of Extended CRISPR RNAs with Enhanced Targeting and Specificity

  Ashley Herring-Nicholas, et al., bioRxiv - Bioengineering 2023

  Quote: ... pwtCas9-bacteria was a gift from Stanley Qi (Addgene plasmid # 44250 ; http://n2t.net/addgene:44250 ; RRID:Addgene_44250). pBbA2c-RFP was a gift from Jay Keasling (Addgene plasmid # 35326 ...