Labshake search
Citations for Addgene :
9101 - 9150 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... 7 μg of pUCmini-iCAP-PHP.eB (a gift from Viviana Gradinaru, Addgene plasmid #103005, RRID:Addgene_103005)24 ...
-
bioRxiv - Genetics 2023Quote: nAChRβ3 gRNA guides were cloned into the pCFD4 vector (Addgene #49411)125 as described at http://www.crisprflydesign.org/wp-content/uploads/2014/06/Cloning-with-pCFD4.pdf
-
bioRxiv - Cancer Biology 2023Quote: ... pLKO.1-neo (Addgene, 13425) was used as the backbone ...
-
bioRxiv - Cancer Biology 2023Quote: ... and HA-HIF2α P405A/P531A/N847Q-pBabe-puro (Addgene, 19006). To generate lentivirus for HIF mutants we subcloned HIF1α mutant from HA-HIF1α P402A/P564A-pcDNA3 (Addgene ...
-
bioRxiv - Genetics 2023Quote: ... Both guides were cloned into pDG458 (Addgene) via golden gate cloning ...
-
bioRxiv - Cancer Biology 2023Quote: PHAGE2-EF1α-LoxP-DsRED-STOP-LoxP-eGFP (Addgene, 62732) and pLKO.1-5xHRE-CRE-ODD plasmids were used for producing MCF7-HypT cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... into pCDH-CMV (Addgene, 72265) using BamHI and NotI restriction sites and HIF2α mutant from the pBabe retroviral vector into pCDH-CMV using BamHI and SalI sites.
-
bioRxiv - Cancer Biology 2023Quote: ... To generate lentivirus for HIF mutants we subcloned HIF1α mutant from HA-HIF1α P402A/P564A-pcDNA3 (Addgene, 18955) into pCDH-CMV (Addgene ...
-
bioRxiv - Developmental Biology 2023Quote: ... guides designed to target the chr21P copy without cutting the chr21M/M2 alleles were cloned into PX459V2 (Addgene plasmid #48139) 85 at the BbsI site by annealing and ligating overlapping oligos ...
-
bioRxiv - Microbiology 2023Quote: ... it included 6.75 μg of the packaging plasmid psPAX2 (a gift from Didier Trono; Addgene plasmid #12260), and 2.25 μg of the envelope plasmid pMD2.G (a gift from Didier Trono ...
-
bioRxiv - Developmental Biology 2023Quote: ... was cloned into AAVS1-Neo-M2rtTA 80 (Addgene plasmid #60843). The UBC promoter was PCR-amplified with flanking PvuII and FseI sites ...
-
bioRxiv - Synthetic Biology 2023Quote: ... gene cat was inserted randomly in the staging plasmid as described in Nadler et al.24 using the following plasmids with some modifications: pUCKanR-MuA-BsaI (Addgene #79769), pATT-Dest (Addgene #79770) ...
-
bioRxiv - Biophysics 2023Quote: ... transformed with pET302-6His-dCas9-halo (Addgene #72269) using 400 µM IPTG for 16 h at 16 °C ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... coli competent cells were transformed by heat shock with a vector pETM33_Nsp5_Mpro (a gift from Ylva Ivarsson; Addgene plasmid # 156475). Bacteria were cultured on LB medium with kanamycin [50 ug/ml] ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and inserted into the double-BbsI restriction site linker of Cq-U6-1_2XBbsI-gRNA plasmid (Addgene#169238) to build a Cq-U6-1-w6-gRNA plasmid ...
-
bioRxiv - Synthetic Biology 2023Quote: ... was PCR amplified from genomic DNA using primers (5’ CAGGTCTCAATCCCGATGTAGAACGCGAG 3’) and (5’ CGGTCTCACATATTGTTTCCTTTCTTTATTCACCGG 3’) and was cloned immediately upstream of SpCas9 amplified from plasmid PX165 (Addgene #48137) (62 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The original bicone construct (A2C-∆ N) was prepared by deleting gvpN from the full GV gene cluster (available on Addgene as plasmid #106473) via KLD mutagenesis using enzymes from New England Biolabs and primers from IDT ...
-
bioRxiv - Cell Biology 2023Quote: ... (Addgene #62988) vector ...
-
bioRxiv - Cell Biology 2023Quote: ... Voeltz (University of Colorado Boulder, Boulder) (RRID:Addgene_49151).
-
bioRxiv - Cell Biology 2023Quote: ... The backbone was plasmid px459 (Addgene #62988) with the following XK gRNA sequence CCGTTGTCTCGGCCACGAACAGG (Guillen-Samander et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... and pDmyc–neo-N1–MAN2A1–GFP (#163649) were obtained from Addgene. pENTR1A and pcDNA3.1 were purchased from Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... necessary for lentivirus production were obtained from Addgene. The plasmids ...
-
bioRxiv - Cell Biology 2023Quote: ... they were electroporated with Yamanaka’s plasmids (plasmid numbers 27078 (human SOX2 and KLF4), 27080 (human L-MYC, LIN28), 27077 (human OCT3/4, shRNA against TP53) from Addgene, www.addgene.org ...
-
bioRxiv - Cell Biology 2023Quote: The producer cell line HEK 293TN was transfected with the packaging (psPAX2, Addgene 12260), envelope (pMD2.G ...
-
bioRxiv - Cell Biology 2023Quote: ... which was a gift from Paul Sternberg (Addgene plasmid # 85583 ...
-
bioRxiv - Genomics 2023Quote: ... was performed at 50 °C with a mixture of Bsp119I-digested Lenti-Neo-iCas9 (Thermo FD0124; Addgene #85400), dCas9-KRAB-MeCP2-T2A amplicon ...
-
bioRxiv - Genomics 2023Quote: ... which was a gift from Feng Zhang (Addgene plasmid #62988 ...
-
bioRxiv - Genomics 2023Quote: ... and pMD2.G (Addgene #12259) into low-passage HEK293T cells in a 10cm dish using Polyjet (SignaGen SL100688 ...
-
bioRxiv - Genomics 2023Quote: ... A dCas9-KRAB-MeCP2-T2A insert was amplified from dCas9-KRAB-MeCP2 (Addgene #110821). A T2A-mCherry Gblock was synthesized by IDT ...
-
bioRxiv - Genomics 2023Quote: ... CROP-seq-opti-Puro-T2A-GFP was assembled by adding a T2A-GFP downstream of Puromycin resistant protein coding sequence on the CROP-seq-opti plasmid (Addgene #106280). Flanking MluI and CsiI digestion sites were added to the GFP Gblock (IDT ...
-
bioRxiv - Cancer Biology 2023Quote: ... Daniele Gilkes (Addgene plasmid #141148 and #141147; http://n2t.net/addgene:141148 and http://n2t.net/addgene:141147; RRID:Addgene_141148 and RRID:Addgene_141147). psPAX2 and pMD2.G were provided by Dr ...
-
bioRxiv - Cancer Biology 2023Quote: ... Daniele Gilkes (Addgene plasmid #141148 and #141147; http://n2t.net/addgene:141148 and http://n2t.net/addgene:141147; RRID:Addgene_141148 and RRID:Addgene_141147). psPAX2 and pMD2.G were provided by Dr ...
-
bioRxiv - Immunology 2023Quote: ... 0.5 µg of a plasmid encoding the vesicular stomatitis virus G protein (pMD2.G, Addgene plasmid #12259), 0.25 µg of a plasmid encoding for the transactivating protein Rev (pRSV-Rev ...
-
bioRxiv - Immunology 2023Quote: ... The medium of the HEK 293T cells was exchanged with 1 mL fresh complete DMEM and cells were transiently co-transfected with four plasmids: 0.25 µg of a plasmid encoding the retroviral structure Gag-Pol proteins (pMDLg/pRRE, Addgene plasmid #12251), 0.5 µg of a plasmid encoding the vesicular stomatitis virus G protein (pMD2.G ...
-
bioRxiv - Developmental Biology 2023Quote: ... and AAVS1 TALEN-R (Addgene plasmid #59026) 84 were used for targeting the UBrtTA ...
-
bioRxiv - Neuroscience 2023Quote: ... Wilson (Addgene viral prep # 105553-AAV1; http://n2t.net/addgene:105553; RRID: Addgene_105553). AAV5-Syn-Flex-ChrimsonR-tdTomato ...
-
bioRxiv - Neuroscience 2023Quote: ... AAVretro-CaMKIIa-mCherry was a gift from Karl Deisseroth (Addgene viral prep # 114469-AAVrg ...
-
bioRxiv - Cell Biology 2023Quote: ... pORANGE cloning template vector (Harold MacGillavry, Addgene # 131471), pCE-mp53DD (Shinya Yamanaka ...
-
bioRxiv - Cell Biology 2023Quote: ... pMD2.G and psPAX2 (Didier Trono, Addgene #12259 and 12260). pLenti Ecto-pHluorin β1 integrin with 4-residue linkers was kindly provided by David A ...
-
bioRxiv - Cell Biology 2023Quote: ... pLenti-Rac1-2G (Olivier Pertz, Addgene # 66111), pcDNA3.1-mGreenLantern (Gregory Petsko ...
-
bioRxiv - Cell Biology 2023Quote: ... The following vectors were gifts from the indicated investigators: pmScarlet-i_C1 (Dorus Gadella, Addgene plasmid # 85044), pORANGE cloning template vector (Harold MacGillavry ...
-
bioRxiv - Immunology 2023Quote: DNA inserts containing the coding DNA sequence (CDS) for each wild type gene were generated by restriction digestion previous amplification from plasmids obtained from Addgene (hMX1 ...
-
bioRxiv - Developmental Biology 2023Quote: ... PDX1 synthesized oligos were amplified and restriction cloned into lentiGuide-puro (Addgene; 52963) and lenti MS2 grna-Puro (Addgene ...
-
bioRxiv - Pathology 2023Quote: cDNAs encoding WT and W70X-prestin were cloned into a pSBtet-pur vector (Addgene) using SfiI sites with or without a C-terminal mTurquoise (mTq2 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and lenti MS2 grna-Puro (Addgene; 52963), while the second library was only cloned into the lenti MS2 grna-Puro backbone by the MSKCC Gene Editing & Screening Core Facility ...
-
bioRxiv - Immunology 2023Quote: ... Next the LentiGuide-Puro plasmid [49] was used to express a single-guide RNA (CD58 sgRNA; 5’-GAGCATTACAACAGCCATCG-3’ and ICAM4 sgRNA: 5’-CCGGGAACACCTGCGTCACG-3’) LentiGuide-Puro (Addgene plasmid # 52963) was a gift from Feng Zhang ...
-
bioRxiv - Immunology 2023Quote: ... Cells were transfected with 0.25 pRSV-Rev (Addgene, 12253), 0.53 µg pMDLg/pRRE (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... The R6K plasmid for mate-out transposition assays was obtained from Addgene (#64968) [66] ...
-
bioRxiv - Molecular Biology 2023Quote: ... The type V Scytonema hofmanni (Sh)CAST was obtained from Addgene (#127922) [15] ...
-
bioRxiv - Molecular Biology 2023Quote: ... The type I-F Vibrio cholerae HE-45 CAST was sub-cloned from Addgene (#130637 and #130633) [14] ...