Labshake search
Citations for Addgene :
8951 - 9000 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... hESCs were electroporated with GATA6-3XFLAG-TetOn-Zeo (entry plasmid 72922, Addgene) and/or SOX17-TetOn-Hygro or GATA3-EGFP-TetO-Hygro (Gift from Dr ...
-
bioRxiv - Cancer Biology 2023Quote: ... A CRISPR/dCas9 vector was constructed as follows: pX330A_dCas9-1×2 (Addgene, Watertown, MA; plasmid ID 63596) (20 ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLenti-CMV-AktE17K-Hygro was generated by replacing GFP in pLenti-CMV-GFP-Hygro with AKTE17K cDNA from pFBD-Akt1(E17K) (Addgene plasmid #86563). pLenti-CMV-Fosl1-Hygro was generated by replacing GFP in pLenti-CMV-GFP-Hygro with Fosl1 cDNA from mouse embryonic fibroblasts (MEF) ...
-
bioRxiv - Microbiology 2023Quote: ... we cloned ∼750 bp of the regions upstream and downstream of the sRNA into the multiple cloning site of pSIE1 (a gift from Andrew Goodman, Addgene plasmid #136355 ...
-
bioRxiv - Immunology 2023Quote: ... Retrovirus were produced by transfecting HEK 293T cells with a mixture of PD-L1-pMIT1.1 (or PD-L2-pMIT1.1) and pCL-Eco (Addgene #12371) using Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2023Quote: To generate a single-vector system CROPseq plasmid expressing both SpCas9 and sgRNA(CROPseq-EFS-SpCas9-P2A-EGFP; Addgene #99248), the EF1a promoter in the CROPseq-Guide-Puro 124 (Addgene plasmid # 86708 ...
-
bioRxiv - Genomics 2023Quote: ... with pBABE-puro SV40 LT plasmid (Addgene # 13970 ...
-
bioRxiv - Genetics 2023Quote: A phenotypically WT (ROSA+/cre CTIPc/c Bcl2+) v-abl immortalized B cell line was infected with lentivirus for doxycycline-inducible SpCas9 (Addgene Plasmid #50661). Single clones were generated and screened for high SpCas9 inducibility after doxycycline treatment (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: lentiCas9-Blast was a gift from Feng Zhang (Addgene plasmid # 52962). For A3A and A3B knockout ...
-
bioRxiv - Genetics 2023Quote: ... The puromycin resistance gene was then subsequently replaced with EGFP using an amplified fragment from the pMLS-SV40-EGFP plasmid 126 (Addgene plasmid # 46919). The expression and activity of the single-vector CROPseq plasmid was tested by cloning in a sgRNA targeting the DNMT3B (sgRNA sequence ...
-
bioRxiv - Genetics 2023Quote: ... The EFS-SpCas9-P2A fragment was amplified from lentiCRISPRv2 125 (Addgene plasmid # 52961) using Q5 high-fidelity DNA polymerase ...
-
bioRxiv - Genetics 2023Quote: ... the EF1a promoter in the CROPseq-Guide-Puro 124 (Addgene plasmid # 86708) was replaced with the EFS promoter to drive the expression of SpCas9 using the Gibson Assembly method (NEBuilder HiFi DNA Assembly master mix) ...
-
bioRxiv - Genetics 2023Quote: ... Each of the sgRNAs was cloned into CROPseq-Guide-pEFS-SpCas9-p2a-puro backbone (Addgene: #99248). The sequences of all sgRNAs templates were confirmed by in-house Sanger sequencing ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-hDlx-GqDREADD-dTomato (Addgene viral prep # 83897-AAV9), into the LHA of four rhesus monkeys to achieve GABAergic neuron-specific chemogenetic gene expression ...
-
bioRxiv - Cell Biology 2023Quote: SH-SY5Y cells stably overexpressing LAMP-1-Flag-RFP (Addgene; #102931) and stained with CellMask Green (1/1000 ...
-
bioRxiv - Cell Biology 2023Quote: ... and psPAX2 (Addgene, #12260) using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... and TGFBR2 (5’-ccttgtagacctcggcgaag-3’) cloned into LentiCRISPRv2 puro (Addgene) (20) ...
-
bioRxiv - Cell Biology 2023Quote: ... viruses were produced in HEK 293T cells by transfecting the corresponding plasmid o interest as well as with pVSVg (Addgene, #8454) and psPAX2 (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... the oligos containing the gene-specific sgRNA target were cloned into the LentiCRISPRv2 Blasticidin (Addgene, #83480). The CRISPR/Cas9 primer sequences were as followed:
-
bioRxiv - Biophysics 2023Quote: ... The TfR coding sequence was amplified from Addgene plasmid # 133451.
-
bioRxiv - Biophysics 2023Quote: ... Nicolas Fawzi at Brown University (Addgene plasmid #98669) which was expressed and purified as previously 16,54 ...
-
bioRxiv - Microbiology 2023Quote: ... a gift from Timothy Lu & Christopher Voigt (Addgene plasmids #68891 ...
-
bioRxiv - Microbiology 2023Quote: ... a gift from Timothy Lu & Christopher Voigt (Addgene plasmids #68891, http://n2t.net/addgene:68891, RRID:Addgene_68891 and #68896 ...
-
bioRxiv - Neuroscience 2023Quote: ... the pipette containing AAVPHP.S-CAG-FLEX-tdTomato virus (Addgene 28306-PHP.S, 1.8×1013 vg/mL) targeted at 2 locations in the mandibular branch spaced 250 um apart ...
-
bioRxiv - Molecular Biology 2023Quote: ... and pMD2.G (Addgene, #12259) into HEK-293T cells using polyethylenimine (PEI ...
-
bioRxiv - Molecular Biology 2023Quote: ... pLV-hTERT-IRES-hygro (Addgene, #85140) was transfected with the packaging vectors psPAX2 (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... and pTRIPZ shCUX1-5328 (Addgene, #100815) following the same protocol as explained before ...
-
bioRxiv - Genetics 2023Quote: A plasmid construct for the expression of Q35::mCherry was generated by inserting the sequence encoding Q35 upstream of mCherry in pGH8 (gift from Erik Jorgensen; Addgene plasmid #19359) and replacing the promoter with a 880-base pair sequence corresponding to the vha-6 promoter using the NEBuilder HiFi DNA Assembly cloning kit ...
-
bioRxiv - Genetics 2023Quote: ... pHD-DsRed-attP-w+ was a gift from Kate O’Connor-Giles (Addgene plasmid # 80898 ...
-
bioRxiv - Genetics 2023Quote: ... Viruses were produced according to standard procedures using commercially available plasmids (pMD2.G Addgene #12259, psPAX Addgene #12260). Briefly ...
-
bioRxiv - Genetics 2023Quote: ... 5 µl of a solution containing a Cre-GFP plasmid (∼2 µg/µl, Addgene #13776) and phenol red (0.1% Sigma #P0290 ...
-
bioRxiv - Genetics 2023Quote: ... anti-Na/K-ATPase (1:1000, Addgene #180089) (membrane protein loading control) ...
-
bioRxiv - Genetics 2023Quote: ... Viruses were produced according to standard procedures using commercially available plasmids (pMD2.G Addgene #12259, psPAX Addgene #12260). Briefly ...
-
bioRxiv - Genetics 2023Quote: ... the pKI1.1R plasmid (Addgene) was linearized by restriction digest with AarI (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... H-RASV12 from pBABE-Puro H-RASV12 (n°12545 Addgene) was cloned in a home-made inducible vector derived from pLVX-Tight-Puro (Clontech ...
-
bioRxiv - Molecular Biology 2023Quote: ... a gift from Judy Lieberman (Addgene plasmid 27219 and 27220 ...
-
bioRxiv - Microbiology 2023Quote: SgRNA/Cas9 cloning vector pX459-mCherry (Cat no. 64324; Addgene) and pJET-UL39R-GFP-p53-Ul39L plasmid were used as controls in all transfection experiments for monitoring the cell viability along with the reporter gene expression.
-
bioRxiv - Microbiology 2023Quote: ... The CoV2-M-IRES-E (Addgene plasmid # 177938), Luc-T20 (Addgene plasmid # 177941 ...
-
bioRxiv - Microbiology 2023Quote: ... sgRNA/Cas9 cloning vector pX459-puro (Addgene, #62988), sgRNA/Cas9 cloning vector pX459-mCherry (Addgene ...
-
bioRxiv - Microbiology 2023Quote: ... Luc-T20 (Addgene plasmid # 177941) and CoV2-N-WT-Hu1 (Addgene plasmid # 177937 ...
-
bioRxiv - Microbiology 2023Quote: pcDNA3.1 (+) IRES GFP plasmid (Addgene, #51406), sgRNA/Cas9 cloning vector pX459-puro (Addgene ...
-
bioRxiv - Microbiology 2023Quote: ... the pIRES2-EGFP-p53 WT Plasmid (Addgene, #49242)
-
bioRxiv - Molecular Biology 2023Quote: Constructs for shRNA targeting Primpol (5’- ATTTAGCCGACACCTAATATT) Smarcal1 (5’- CTGATTCAAGAGAAGATTAAA) and Smug1 (5’- AACTATGTGACTCGCTACT) were designed and inserted into pLKO.1neo plasmid (Addgene #13425). Lentiviruses were generated using a standard protocol (Feng and Jasin ...
-
bioRxiv - Genomics 2023Quote: ... psPAX2 and pMD2.G were gifts from Didier Trono (Addgene plasmid #12260 and #12259). pLV_hEF1a_rtTA3 was a gift from Ron Weiss addgene #61472 [40].
-
bioRxiv - Genomics 2023Quote: ... Each well was treated with 1.25 µg CRISPRoff plasmid (Addgene plasmid #167981), 1.25 µg gRNA plasmid (described above) ...
-
bioRxiv - Genomics 2023Quote: ... Each spacer’s sense and antisense oligonulceotide strands were annealed and ligated into a gRNA expression vector (pGuide, Addgene plasmid #64711). After transformations into competent E ...
-
bioRxiv - Genomics 2023Quote: ... Col2a1 sgRNA was cloned in the pX459 plasmid (Addgene, 48139) and designed to target CRISPR–Cas9 to chr15:97903847 (mm39) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The nSauCas9D10A plasmid used for the orthogonal R-loop assay was also cloned by SDM using CMV-dSauCas9 (Addgene #138162) as a template ...
-
bioRxiv - Molecular Biology 2023Quote: ... U6-driven sgRNA plasmids for the various Cas effectors were cloned using pBluescript sgRNA expression plasmids (Addgene #122089 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and pL1P4-TaU6 (Addgene #165600), as described in Smedley et al. ...