Labshake search
Citations for Addgene :
8901 - 8950 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: pBabe-puro LEF1 (the long isoform) was a gift from Joan Massague (Addgene plasmid # 27023 ...
-
bioRxiv - Genomics 2023Quote: ... The oligomer sequence was obtained from the data and the surrounding sequence was retrieved from the human STAP-seq screening vector sequence (Addgene ID: 125150). Both basepair level and TSS-level prediction and experimental measurements were compared ...
-
bioRxiv - Cell Biology 2023Quote: ... pCMV-Tag/WT M87 (Addgene #89322), pCIG2-SNAP-M87 (generated for this study from pCIG2-GFP-MACF43 by replacing GFP with SNAP-tag from pSNAPf vector (New England Biolabs ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFP-C3-Syb (Addgene #42308; used to make pmScarlet-Syb), pCIG2-mScarlet-Syb-IRES-GFP-MACF43 (generated for this study by inserting mScarlet-Syb into pGIC2-GFP-MACF43 using sticky-end cloning at XbaI/PspXI) ...
-
bioRxiv - Genomics 2023Quote: ... annealed and cloned into pU6-sgRNA EF1Alpha-puro-T2A-BFP expression plasmid (Addgene #60955) as previously described 118 ...
-
bioRxiv - Genomics 2023Quote: ... and pCMV-VSV-G (envelope)(Addgene #8454) plasmids at a ratio of 4:3:1 ...
-
bioRxiv - Genomics 2023Quote: ... the DNA sequence of KRAB repressor domain was amplified by PCR from the pHAGE TRE dCas9-KRAB (Addgene plasmid #50917) and cloned in frame into the PB-TRE-dCas9-VPR backbone (Addgene plasmid #63800 ...
-
bioRxiv - Genomics 2023Quote: ... and cloned in frame into the PB-TRE-dCas9-VPR backbone (Addgene plasmid #63800) within the AscI/AgeI sites ...
-
bioRxiv - Genomics 2023Quote: ... We expressed sgRNAs upon cloning into lentiGuide-Puro sgRNA backbone (Addgene #52963) within BsmBI (Esp3I ...
-
bioRxiv - Genomics 2023Quote: ... 7μg of pMD2G (envelope)(Addgene #12259), 94μL of RT CaCl2 and water up to 750μL ...
-
bioRxiv - Genomics 2023Quote: Perturb-seq GBC library (Adamson et al. 2016, Dixit et al. 2016) was a gift from Jonathan Weissman (Addgene ID #85968). The library contains a random 18-nt guide barcode (GBC ...
-
bioRxiv - Immunology 2023Quote: ... The Rosa26uLIPSTIC targeting vector is a modification of the Ai9 Rosa26 conditional expression vector32 (Addgene plasmid #22799). G5-Thy1.1 cDNA preceded by a mouse CD40 signal peptide was inserted into a NruI enzyme site in Ai9 immediately downstream of the first loxP site ...
-
bioRxiv - Immunology 2023Quote: ... the SARS-CoV-2 S 6P expression vector was a gift from Jason McLellan (Addgene plasmid #154754). The secreted protein was captured by Strep-Tactin affinity chromatography ...
-
bioRxiv - Neuroscience 2023Quote: ... Wilson (Addgene plasmid # 112865; http://n2t.net/addgene:112865; RRID:Addgene_112865).
-
bioRxiv - Neuroscience 2023Quote: ... and pCAG_smFP Myc (Addgene plasmid # 59757 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV pmSyn1-EBFP-Cre was a gift from Hongkui Zeng (Addgene plasmid # 51507 ...
-
bioRxiv - Neuroscience 2023Quote: ... and pCAG_smFP Myc (Addgene plasmid # 59757; http://n2t.net/addgene:59757; RRID:Addgene_59757) were gifts from Loren Looger23.
-
bioRxiv - Neuroscience 2023Quote: ... Wilson (Addgene plasmid # 112862; http://n2t.net/addgene:112862; RRID:Addgene_112862). AAV2/5 ...
-
bioRxiv - Neuroscience 2023Quote: ... iCreV: pAAV-EF1a-iCreV was a gift from Hongkui Zeng (Addgene plasmid # 140135; http://n2t.net/addgene:140135; RRID:Addgene_140135)43 ...
-
bioRxiv - Neuroscience 2023Quote: ... pCAG_smFP V5 (Addgene plasmid # 59758; http://n2t.net/addgene:59758; RRID:Addgene_59758), pCAG_smFP FLAG (Addgene plasmid # 59756 ...
-
bioRxiv - Neuroscience 2023Quote: ... iCreV: pAAV-EF1a-iCreV was a gift from Hongkui Zeng (Addgene plasmid # 140135 ...
-
bioRxiv - Neuroscience 2023Quote: ... Wilson (Addgene plasmid # 112862 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV-FLEX-GFP was a gift from Edward Boyden (Addgene plasmid # 28304 ...
-
bioRxiv - Neuroscience 2023Quote: ... Wilson (Addgene viral prep # 105550-PHPeB; http://n2t.net/addgene:105550; RRID:Addgene_105550).
-
bioRxiv - Neuroscience 2023Quote: ... ERCreER: pCAG-ERT2CreERT2 was a gift from Connie Cepko (Addgene plasmid # 13777 ...
-
bioRxiv - Neuroscience 2023Quote: ... Wilson (Addgene viral prep # 105550-PHPeB ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/5: pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ...
-
bioRxiv - Neuroscience 2023Quote: ... pUCmini-iCAP-PHP.eB was a gift from Viviana Gradinaru (Addgene plasmid # 103005; http://n2t.net/addgene:103005; RRID:Addgene_103005)4 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV-FLEX-GFP was a gift from Edward Boyden (Addgene plasmid # 28304; http://n2t.net/addgene:28304; RRID:Addgene_28304). Reverse-complement inserts for smFPs and the 4×6T cassette were generated via PCR ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV pmSyn1-EBFP-Cre was a gift from Hongkui Zeng (Addgene plasmid # 51507; http://n2t.net/addgene:51507; RRID:Addgene_51507). Two copies of single miR-T sequences were added in primers ...
-
bioRxiv - Neuroscience 2023Quote: ... Wilson (Addgene plasmid # 112865 ...
-
bioRxiv - Neuroscience 2023Quote: ... Dre: AAV phSyn1(S)-DreO-bGHpA was a gift from Hongkui Zeng (Addgene plasmid # 50363 ...
-
bioRxiv - Neuroscience 2023Quote: ... pCAG_smFP FLAG (Addgene plasmid # 59756; http://n2t.net/addgene:59756; RRID:Addgene_59756), and pCAG_smFP Myc (Addgene plasmid # 59757 ...
-
bioRxiv - Neuroscience 2023Quote: ... pCAG_smFP V5 (Addgene plasmid # 59758 ...
-
bioRxiv - Neuroscience 2023Quote: ... ERCreER: pCAG-ERT2CreERT2 was a gift from Connie Cepko (Addgene plasmid # 13777; http://n2t.net/addgene:13777; RRID:Addgene_13777)42 ...
-
bioRxiv - Neuroscience 2023Quote: Rep/cap plasmids: PHP.eB: pUCmini-iCAP-PHP.eB was a gift from Viviana Gradinaru (Addgene plasmid # 103005 ...
-
bioRxiv - Cell Biology 2023Quote: The CRISPR HR oligo was generated by PCR using UPRT F and UPRT R primers and the 5’UPRT-pAPT1-APT1-EmGFP-3’UPRT plasmid as a template with Q5 high fidelity polymerase and 50ul of PCR reaction was cotransfected with 25 μg of pSag1::Cas9::U6::sgUPRT plasmid [45] (AddGene plasmid # 54467) into 1×107 TgMyoF-mAID parasites [39] ...
-
bioRxiv - Genetics 2023Quote: ... and MIA PaCa-2 cell lines were lentivirally transduced with shRNAmir constructs cloned into pRRL-TRE3G-GFP-miRE-PGK-Puro-IRES-rtTA3 backbone (LT3GEPIR, Addgene plasmid #111177). 500 cells were seeded in duplicates in 96-well plates and treated with 1 µg/ml dox for 9-10 days and analyzed with Incucyte (Sartorius) ...
-
bioRxiv - Genetics 2023Quote: ... EPP2 and RN2 cells were retrovirally transduced with shRNAmir constructs cloned into pMSCV-miR-E-PGK-Neo-IRES-mCherry backbone (LENC; Addgene plasmid #111163), and initial infection levels were determined by flow cytometry based on mCherry expression 4 days post transduction (day 0).
-
bioRxiv - Genetics 2023Quote: ... Guide RNAs TTCTTCAGACTTCAGAACAT or CTGAAGAAAATTTACAAATC were cloned into the pSpCas9(BB)-2A-GFP plasmid (pX458; Addgene plasmid 48138) and used in a co-transfection ...
-
bioRxiv - Genomics 2023Quote: ... and pCMV VSV-G (Addgene, plasmid #8454) lentiviral particles.
-
bioRxiv - Genomics 2023Quote: pLenti CMV GFP Puro (Addgene, plasmid #17448) plasmid was cut with BsrgI and SalI restriction enzymes ...
-
bioRxiv - Genomics 2023Quote: ... Cells were transfected with each DNMT3B or GFP-only construct in addition to pCMV-dR8.2 dvpr (Addgene, plasmid #8455) and pCMV VSV-G (Addgene ...
-
bioRxiv - Genomics 2023Quote: ... lentiviral particles encoding dCas9-BFP-KRAB were generated by transfecting HEK293T cells with plasmids encoding dCas9-BFP-KRAB (pHR-SFFV-dCas9-BFP-KRAB, Addgene 46911) and the ViraPower lentiviral packaging mix (ThermoScientific) ...
-
bioRxiv - Genomics 2023Quote: ... a filtered lentiviral supernatant carrying a payload of dCas9-GCN4-BFP (pHRdSV40-dCas9-10xGCN4_v4-P2A-BFP, Addgene 60903) or scFV-GCN4-GFP-VP64 (pHRdSV40-scFv-GCN4-sfGFP-VP64-GB1-NLS ...
-
bioRxiv - Genomics 2023Quote: ... Oligonucleotides containing these sequences and flanked with adapters with homology to a CROP-seq vector that we have previously altered23 to contain a CRIPSRi optimized guide RNA backbone79 (CROP-seq-OPTI, Addgene 106280) were synthesized individually for experiments related to Fig ...
-
bioRxiv - Genomics 2023Quote: ... or scFV-GCN4-GFP-VP64 (pHRdSV40-scFv-GCN4-sfGFP-VP64-GB1-NLS, Addgene 60904) were generated as described above ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV-Ef1a-dDIO hChR2(H134R)-EYFP was a gift from Karl Deisseroth (Addgene plasmid # 55640; http://n2t.net/addgene:55640; RRID:Addgene_55640)44.
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/5: pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964; http://n2t.net/addgene:104964; RRID:Addgene_104964). AAV2/9 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV phSyn1(S)-DreO-bGHpA was a gift from Hongkui Zeng (Addgene plasmid # 50363; http://n2t.net/addgene:50363; RRID:Addgene_50363)51 ...