Labshake search
Citations for Addgene :
8851 - 8900 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... pCfB2904(XI-3 MarkerFree) was a gift from Irina Borodina (Addgene plasmid # 73276 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Mouse ULK1 cDNA was isolated from a p3xFLAG-CMV14-mULK1 vector (#24301, Addgene) by PCR and cloned into the Halo-tagged pFN21A vector (Promega ...
-
bioRxiv - Molecular Biology 2023Quote: ... The AMPKγ1 mutant vector wherein Ser260 and Thr262 were replaced with alanine was created using parent-template backbone mouse AMPKγ1- full-length vector (# 15996, Addgene) and primers with the desired mutation ...
-
bioRxiv - Molecular Biology 2023Quote: ... pAMPK- alpha1-full-length (#27297, Addgene), and AMPK-β1-FLAG (#40602 ...
-
bioRxiv - Molecular Biology 2023Quote: Polymerase chain reaction (PCR) was used to isolate mouse AMPKγ1 cDNA from a mouse AMPKγ1-HA vector (#40605, Addgene, Watertown, MA, USA). Mouse AMPKγ1 cDNA was then cloned into the 3xFLAG-CMV10 vector (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: hBAX C3-EGFP was a gift from Richard Youle (Addgene plasmid # 19741). The plasmid was linearized using the restriction endonucleases AgeI and SacI ...
-
bioRxiv - Cell Biology 2023Quote: EGFP-BAK was a gift from Richard Youle (Addgene plasmid # 32564). The plasmid was linearized using the restriction endonucleases AgeI and XhoI ...
-
bioRxiv - Cell Biology 2023Quote: ... which was a gift from Feng Zhang (Addgene plasmid # 48138). The following oligonucleotides were annealed and integrated into pX458 after linearization with the BbsI restriction endonuclease:
-
bioRxiv - Cell Biology 2023Quote: ... which was a gift from Feng Zhang (Addgene plasmid # 42230). The following oligonucleotides were annealed and integrated into pX330 after linearization with the BbsI restriction endonuclease:
-
bioRxiv - Cell Biology 2023Quote: CRISPRi sgRNAs were cloned into either BFP- or GFP-containing lentiviral vectors (Addgene plasmids #60955 and #111596). To generate double knockdown cells sgRNAs were ligated into IGI-P1589 containing a Neomycin resistance cassette ...
-
bioRxiv - Cell Biology 2023Quote: ... which was a gift from Eric Campeau (Addgene plasmid # 29644), with the following primers ...
-
bioRxiv - Cell Biology 2023Quote: ... which was a gift from Su-Chun Zhang (Addgene plasmid #68461), was linearized by using the restriction endonucleases SalI and EcoRV.
-
bioRxiv - Developmental Biology 2023Quote: BE3 plasmid was purchased from Addgene (Cat# 73021) and linearized with NotI ...
-
bioRxiv - Microbiology 2023Quote: ... Didier Trono (Cat# 12259; http://n2t.net/addgene:12259; RRID: Addgene_12259), and pSpCas9(BB)-2A-Puro (PX459 ...
-
bioRxiv - Microbiology 2023Quote: ... The annealed oligos were diluted 250-fold with water and used for ligation with the pSpCas9(BB)-2A-Puro (PX459) V2.0 vector (Addgene, Cat# 62988), which was predigested with BbsI-HF (NEB ...
-
bioRxiv - Immunology 2023Quote: ... 0.53 µg pMDLg/pRRE (Addgene, 12251), 0.35 µg pMD2.G (Addgene ...
-
bioRxiv - Immunology 2023Quote: ... Lentivirus was produced in HEK 293T using psPAX2 (Addgene plasmid # 12260) and VSV-G (Addgene plasmid # 12259 ...
-
bioRxiv - Immunology 2023Quote: ... and VSV-G (Addgene plasmid # 12259) packaging plasmids ...
-
bioRxiv - Neuroscience 2023Quote: ... was obtained from Addgene, and the PAX6 guideRNA (5’ GGCCAGTATTGAGACATATC 3’ ...
-
bioRxiv - Neuroscience 2023Quote: ... WT mice were injected with 400 nL of AAV9-hSyn-ACh4.3 (ACh3.0) (WZ Biosciences, YL001003-AV9-PUB, RRID:Addgene_121922).
-
bioRxiv - Cell Biology 2023Quote: ... and pDM291-tetR-tup11Δ70 (Addgene plasmid # 41027; http://n2t.net/addgene:41027; RRID:Addgene_41027)49 ...
-
bioRxiv - Cell Biology 2023Quote: ... and pDM291-tetR-tup11Δ70 (Addgene plasmid # 41027 ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmids expressing murine PKA (mPKA) RIIα and ER membrane targeting signal fused miniTurbo promiscuous biotin ligase (ER-mTb) were obtained from Addgene (#45527 and #107174, respectively). The mPKA RIIα sequence was PCR amplified and cloned into the upstream of the mTb sequence ...
-
bioRxiv - Genomics 2023Quote: Third-generation lentiviruses pUBIQ-rtTA (Addgene #20342), tetO-ASCL1-LMX1B-NURR1-PuroR (Addgene #182298) ...
-
bioRxiv - Genomics 2023Quote: ... transfection kit and packaging plasmids pMD2.G (Addgene #12259) and psPAX2 (Addgene #12260) ...
-
bioRxiv - Genomics 2023Quote: ... and 12,096 sgRNAs were selected from the extended CRISPR library published by the Broad Institute’s Genetic Perturbation Platform (Addgene #73178). Additionally ...
-
bioRxiv - Genomics 2023Quote: ... 20,520 sgRNAs were selected from the TKO V3 CRISPR library (Addgene #90294), and 12,096 sgRNAs were selected from the extended CRISPR library published by the Broad Institute’s Genetic Perturbation Platform (Addgene #73178) ...
-
bioRxiv - Genomics 2023Quote: ... and psPAX2 (Addgene #12260). HEK293FT cells were transfected with a plasmid ratio of 2:3:4 (by mass ...
-
bioRxiv - Cell Biology 2023Quote: ... pFA6a-GBP-mCherry-kanMX6 was a gift from Quanwen Jin (Addgene plasmid # 89068; http://n2t.net/addgene:89068; RRID:Addgene_89068)50 ...
-
bioRxiv - Cell Biology 2023Quote: ... pFA6a-KanMX-tetO-pCyc1 (TetP) (Addgene plasmid # 41023; http://n2t.net/addgene:41023; RRID:Addgene_41023); and pDM291-tetR-tup11Δ70 (Addgene plasmid # 41027 ...
-
bioRxiv - Cell Biology 2023Quote: ... see table S8) into a lentiviral pU6-sgRNA EF-1α-Puro-T2A-BFP vector digested with BstXI/BlpI (Addgene, #84832). The exception was the sgRNAs for TTC1 and Control used in the Seahorse assay ...
-
bioRxiv - Cell Biology 2023Quote: ... we used a programmed dual sgRNA guide vector (Addgene #140096) (see table S8 for list of dual guide combinations and respective protospacer sequences) ...
-
bioRxiv - Cell Biology 2023Quote: ... The sgRNA was generated by annealed oligo cloning into a chimeric human codon-optimized SpCas9 and pU6-driven guide RNA expression plasmid (pX330, Addgene #42230) with BbsI digestion (see table S8 for protospacer sequence) ...
-
bioRxiv - Cell Biology 2023Quote: ... which was a gift from Paul Sternberg (Addgene plasmid # 85583; http://n2t.net/addgene:85583; RRID: Addgene_85583) (Wang et al. ...
-
bioRxiv - Microbiology 2023Quote: ... lentiCRISPR v2 was a gift from Feng Zhang (Addgene plasmid# 52961 ...
-
bioRxiv - Microbiology 2023Quote: ... and psPAX2 (12260; http://n2t.net/addgene:12260; RRID: Addgene_12260) were gifts from Dr ...
-
bioRxiv - Microbiology 2023Quote: ... pEIAV-SIN6.1 CGFPW (44171; http://n2t.net/addgene:44171; RRID: Addgene_44171) and pEV53D (44168 ...
-
bioRxiv - Cell Biology 2023Quote: ... The RAD52KO cell line was generated from the RAD52WT line by CRISPR-Cas9-mediated deletion of the 1.1kb region between exons 3 and 4 using guide RNAs sg1 and sg2 cloned into px330 (Addgene #42230) as previously described (Kelso et al ...
-
bioRxiv - Cell Biology 2023Quote: Lentiviral expression constructs were packaged in HEK293FT cells using calcium phosphate transfection of psPAX2 and pMD2.G (kind gifts of D. Trono; Addgene #12260, #12259) and pTAT (kind gift of P ...
-
bioRxiv - Cell Biology 2023Quote: ... which was digested with EcoRI and BamHI restriction enzymes and cloned into the EcoRI/BamHI-double-digested mClover2-C1 vector (Addgene plasmid#54577). Plasmid vectors for expressing human actin binding protein Lifeact (mRuby2-tagged Lifeact ...
-
bioRxiv - Cell Biology 2023Quote: ... mVenus-Integrin-Beta1-N-18 plasmid (Addgene plasmid #56330) was obtained from Addgene (USA) ...
-
bioRxiv - Cell Biology 2023Quote: ... was obtained from Addgene (USA). Transfection was performed using Lipofectamine LTX and Plus reagent (Invitrogen Life Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... the origin and sacB were cloned from pKM461 (a gift from Kenan Murphy, Addgene #108320), the AraC inducible module was cloned from pKD46 (CGSC #7739 ...
-
bioRxiv - Microbiology 2023Quote: ... the XylS inducible oligo recombineering module was cloned from pORTMAGE-Ec1 (a gift from George Church, Addgene #138474)(20) ...
-
bioRxiv - Neuroscience 2023Quote: ... 300 nL of AAV9.hSyn.DIO.tdTomato.T2A.GIRK2 were co-injected with 300 nL of AAV9-EF1a-DIO-mChrM4-P2A-eGFP-WPRE-SV40pA (Virovek, provided by Drs. Ying Zhu and Jonathan Javitch) or AAV5.EF1a.DIO.EYFP (Addgene, 27056, RRID:Addgene_27056) respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... 300 nL of AAV9.hSyn.DIO.tdTomato.T2A.GIRK2 were co-injected with 300 nL of AAV9-EF1a-DIO-mChrM4-P2A-eGFP-WPRE-SV40pA (Virovek, provided by Drs. Ying Zhu and Jonathan Javitch) or AAV5.EF1a.DIO.EYFP (Addgene, 27056, RRID:Addgene_27056) respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... The Cas9-guideRNA plasmid pSpCas9(BB)-2A-GFP (Addgene, 48138) was obtained from Addgene ...
-
bioRxiv - Microbiology 2023Quote: ... Fragments of the violacein operon were cloned from pBLxVi5 (a gift from Christopher Reisch, Addgene #167516) into pInt_attP1_kanR (26) ...
-
bioRxiv - Microbiology 2023Quote: ... The temperature sensitive Xis module for pInt_attP1_tsXis_sacB_kanR was cloned from pCP20 (CGSC #7629) and pBad-Xis/Int Reset Flipper (a gift from Drew Endy, Addgene #38207) (27) ...
-
bioRxiv - Microbiology 2023Quote: ... the library cloning site with transcriptional terminators was cloned from pLibAcceptorV2 (a gift Guillaume Urtecho and Sriram Kosuri, Addgene #106250). In several cases synthetic terminators were added downstream of genes that appeared to lack transcriptional terminators (28).