Labshake search
Citations for Addgene :
6951 - 7000 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... were cloned into plasmid 438B (pFastBac His6 TEV cloning vector with BioBrick Polypromoter LIC subcloning, Addgene plasmid #55219). Constructs 438B-INTS3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and pLEX307-TMPRSS2-blast (RRID:Addgene_158458) plasmids ...
-
bioRxiv - Molecular Biology 2023Quote: ... Human TMPRSS2 expression in VeroE2T and in VeroE6 cells (VeroE6-TMPRSS2) was achieved by infecting the cells with a 2nd generation lentiviral vector pLEX307-TMPRSS2-blast (Addgene plasmid #158458) as a transfer vector ...
-
bioRxiv - Molecular Biology 2023Quote: ... Lentiviruses were generated by transfecting HEK-293T cells with pCMVR8.74 (RRID:Addgene_22036), pMD2G (RRID:Addgene_12259) ...
-
bioRxiv - Molecular Biology 2023Quote: ... mscv2.2-IRESGFP retroviral vectors containing murine Nlrc4 (Addgene plasmid #60199) or human NLRC4 were used ...
-
bioRxiv - Molecular Biology 2023Quote: ... as well as overhangs for assembly into the STARR-seq vector (Addgene #99296; Supplemental Table 1) according to the manufacturer’s instruction (10 to 11 cycles of amplification) ...
-
bioRxiv - Neuroscience 2023Quote: ... AAVrg-hSyn-DIO-mCherry (pAAV-hSyn-DIO-mCherry was a gift from Bryan Roth Addgene viral prep # 50459-AAVrg; http://n2t.net/addgene:50459; RRID:Addgene_50459) was substituted for AAVrg-hSyn-DIO-hM4D(Gi)-mCherry ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-hSyn-Cre (pENN.AAV.hSyn.Cre.WPRE.hGH was a gift from James M. Wilson Addgene viral prep # 105553-AAV9 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-hSyn-Cre (pENN.AAV.hSyn.Cre.WPRE.hGH was a gift from James M. Wilson Addgene viral prep # 105553-AAV9; http://n2t.net/addgene:105553; RRID:Addgene_105553) was injected into bilateral NR (~100 nL at a depth of −4.1 mm) ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-axon-GCaMP6s-P2A-mRuby3 (pAAV-hSynapsin1-axon-GCaMP6s-P2A-mRuby3 was a gift from Lin Tian Addgene viral prep # 112005-AAV9; http://n2t.net/addgene:112005; RRID:Addgene_112005) was injected (~50 nL at a depth of 4.1 mm below the surface of the dura ...
-
bioRxiv - Molecular Biology 2023Quote: ... synthesized deaminases were cloned into pnCas9-PBE vector (Addgene#98164), yielding vectors with Ubi-1::NLS-deaminase-linker-nCas9(D10A)-UGI-NLS::CaMV expression cassettes.
-
bioRxiv - Molecular Biology 2023Quote: ... and cloned into pX601 vector (Addgene#61591), followed by sgRNA target sequence cloning steps.
-
bioRxiv - Molecular Biology 2023Quote: The plant sgRNA vectors (rice U3 promoter drives sgRNA) were constructed as reported previously using the pOsU3 backbone (Addgene#170132)60 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and cloned into pCMV_BE4max vector (Addgene#112093), yielding vectors with CMV::NLS-TALE-deaminase-UGI-NLS::bGH expression cassettes.
-
bioRxiv - Molecular Biology 2023Quote: ... and cloned into pBSE901 (Addgene#91709) vector ...
-
bioRxiv - Molecular Biology 2023Quote: ... synthesized deaminases-SpCas9-2UGI were cloned into p2T-CMV-ABEmax-BlastR vector (Addgene#152989), yielding vectors with CMV::NLS-deaminase-linker-nCas9(D10A)-2xUGI-NLS::bGH expression cassettes.
-
bioRxiv - Molecular Biology 2023Quote: ... was a gift from Alice Ting (Addgene plasmid # 154939 ...
-
bioRxiv - Molecular Biology 2023Quote: ... was a gift from Alice Ting (Addgene plasmid # 154939; http://n2t.net/addgene:154939; RRID:Addgene_154939), generated as described in (Han et al ...
-
bioRxiv - Molecular Biology 2023Quote: ... The correct cassette integration was validated by transfecting the I-SceI overexpression plasmid (Addgene, 26477) for 48 h and measuring GFP induction by flow cytometry ...
-
bioRxiv - Molecular Biology 2023Quote: ... were fluorescently tagged in two steps by first cloning the ORFs into plasmid H6-mOrange (pET Biotin His6 mOrange LIC cloning vector, Addgene plasmid #29723) and then into plasmid 438B.
-
bioRxiv - Molecular Biology 2023Quote: ... which was a gift from John Dueber (Addgene kit # 1000000061). The assembly reaction conditions were 50 cycles ...
-
bioRxiv - Molecular Biology 2023Quote: ... which was a gift from John Dueber (Addgene kit # 1000000061). Note that the insert sequences were amplified in two separate fragments ...
-
bioRxiv - Molecular Biology 2023Quote: ... we removed the 5XBoxB sequence from the pAc5.1C-FLuc-Stop-5BoxB plasmid (Addgene #21301) between the EcoRI and XhoI sites and replaced with oligos encoding for the 3xBoxB or 1xBoxB stem loop sequences ...
-
bioRxiv - Molecular Biology 2023Quote: ... The CDS for AGO1 and GW182 were PCR amplified from pAFW-Ago1 (Addgene #50553) and LD47780 (DGRC ...
-
bioRxiv - Molecular Biology 2023Quote: ... the dFMRP CDS was PCR amplified from pAc5.1-EGFP-dFMRP and transferred into pET-His6-MBP-TEV (Addgene #29656) by ligation-independent cloning following QB3 Macrolab protocols (https://qb3.berkeley.edu/facility/qb3-macrolab/) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and its cognate transactivator protein (3G) gene (derived from AAVS1_Puro_Tet3G_3xFLAG_Twin_Strep, a gift from Yannick Doyon: Addgene plasmid #92099; Dalvai et al., 2015). The resulting plasmid was named as DOGGp in this work ...
-
bioRxiv - Molecular Biology 2023Quote: ... the DNA region encoding TFAM-mScarlet fusion was excised from the pcDNA3-TFAM-mScarlet plasmid (Addgene ref #129573) using BamHI and EcoRI endonucleases and inserted into the pWPXL plasmid (Addgene ref #12257) ...
-
bioRxiv - Molecular Biology 2023Quote: ... using BamHI and EcoRI endonucleases and inserted into the pWPXL plasmid (Addgene ref #12257). To obtain the TFAM construct containing the 3’mitoUTR (3’mitoUTR_TFAM-mScarlet_pWPXL) ...
-
bioRxiv - Molecular Biology 2023Quote: The DNA fragment encoding dLwaCas13a was PCR-amplified using pC035-dLwaCas13a-msfGFP (a gift from Feng Zhang; Addgene plasmid #91925 ...
-
bioRxiv - Molecular Biology 2023Quote: ... shRNA containing lentiviral constructs or a scrambled lentivrial construct (Addgene plasmid #162011) together with psPAX-2 (Addgene plasmid #12260 ...
-
bioRxiv - Molecular Biology 2023Quote: ... was inserted into the pC016-LwCas13a guide expression backbone with U6 promoter (a gift from Feng Zhang; Addgene plasmid #91906; http://n2t.net/addgene:91906; RRID: Addgene_91906). The gRNA expression plasmids are listed in Table S1.
-
bioRxiv - Molecular Biology 2023Quote: ... was inserted into the pC016-LwCas13a guide expression backbone with U6 promoter (a gift from Feng Zhang; Addgene plasmid #91906 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The DNMT1-targeting sgRNA (5′-GGCGGTACGCGCCGGCATCT –3′) was cloned into pX330 hSpCas9 expressing vector (Addgene #42230) and verified by sequencing.
-
bioRxiv - Developmental Biology 2023Quote: ... sgRNA vectors targeting TTCACACATACAATGCACTG and GATGGTAAGCCTCATCACAG of the human HIF-1α gene (ENSG00000100644) were cloned into the pLH-spsgRNA2 vector (64114, Addgene). For GHRH-R activation ...
-
bioRxiv - Microbiology 2023Quote: ... a gift from Feng Zhang (Addgene plasmid #48138). A549 cells were transfected with the above plasmids at 60% confluency and sorted by flow cytometry based on the expression of GFP at 48 h post-transfection ...
-
bioRxiv - Neuroscience 2023Quote: ... pSpCas9(BB)–2A–Puro (62988, Addgene). The resulting plasmid was transfected into the wild-type human iPSCs using Lipofectamine (CMAX00015 ...
-
bioRxiv - Physiology 2023Quote: ... and 15 μg of pLV6-BMAL1-Luc vector (Addgene), and 25 μg of P3000 reagent was added ...
-
bioRxiv - Physiology 2023Quote: ... pAAV-EF1a-DIO-hM3D(Gq)-mCherry was a gift from Bryan Roth (Addgene plasmid # 50460; http://n2t.net/addgene:50460; RRID: Addgene_50460). pAAV-CAG-Flex.GCaMP6f.WPRE (3.15×1013 vg/ml ...
-
bioRxiv - Physiology 2023Quote: ... pAAV-CAG-Flex.GCaMP6f.WPRE (3.15×1013 vg/ml, working dilution 1:10, Addgene plasmid #100835-AAV5 ...
-
bioRxiv - Physiology 2023Quote: ... pAAV-EF1a-DIO-hM3D(Gq)-mCherry was a gift from Bryan Roth (Addgene plasmid # 50460 ...
-
bioRxiv - Physiology 2023Quote: ... pAAV-EF1α-DIO-mCherry (3.6×1012 vg/ml, Addgene plasmid #50462-AAV5; http://www.addgene.org/50462/; RRID: Addgene_50462), pAAV-EF1a-DIO-hM3D(Gq)-mCherry was a gift from Bryan Roth (Addgene plasmid # 50460 ...
-
bioRxiv - Physiology 2023Quote: ... working dilution 1:5) or d-Light1 (pAAV-CAG-dLight1.1, Addgene viral prep # 111067-AAV5 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: SH-SY5Y cells were plated in 6-well plates at a density of 400,000 cells per well and transfected the following day with pEGFP-n1-APP (69924, Addgene plasmid) using the jetOPTIMUS transfection reagent (Polyplus ...
-
bioRxiv - Neuroscience 2023Quote: ... HyPerRed-mito was a gift from Vsevolod Belousov (Addgene plasmid # 60247 ...
-
bioRxiv - Neuroscience 2023Quote: ... pLenti-LifeAct-tdTomato was a gift from Weiping Han (Addgene plasmid # 64048; http://n2t.net/addgene:64048; RRID:Addgene_64048). HyPerRed-mito was a gift from Vsevolod Belousov (Addgene plasmid # 60247 ...
-
bioRxiv - Neuroscience 2023Quote: ... pLenti-LifeAct-tdTomato was a gift from Weiping Han (Addgene plasmid # 64048 ...
-
bioRxiv - Neuroscience 2023Quote: ... pEGFP-Q23 and pEGFP-Q74 were gifts from David Rubinsztein (Addgene plasmid # 40262; http://n2t.net/addgene:40262; RRID:Addgene_40262). pLenti-LifeAct-tdTomato was a gift from Weiping Han (Addgene plasmid # 64048 ...
-
bioRxiv - Neuroscience 2023Quote: ... pEGFP-Q23 and pEGFP-Q74 were gifts from David Rubinsztein (Addgene plasmid # 40262 ...
-
bioRxiv - Neuroscience 2023Quote: ... either AAV5-hM4Di-hsyn-DIO-mCherry or AAV5-hsyn-DIO-EYFP (Addgene) was injected targeted in DAT-IRES-Cre mice in either the medial or lateral nucleus accumbens shell using the same coordinates as above ...
-
bioRxiv - Neuroscience 2023Quote: ... and psPAX2 (Addgene, #12260). Lentiviral supernatants were collected 36 hours after transfection ...