Labshake search
Citations for Addgene :
7001 - 7050 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: lenti SYN-FLAG-dCas9-KRAB-MeCP2 was a gift from Jeremy Day (Addgene plasmid # 155365; http://n2t.net/addgene:155365; RRID:Addgene_155365)
-
bioRxiv - Neuroscience 2023Quote: pCMV-VSV-G was a gift from Bob Weinberg (Addgene plasmid # 8454 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV-hSyn-DIO-EGFP was purchased from Addgene (Watertown, MA 02472, USA). All viruses were aliquoted and stored at −80 °C until use.
-
bioRxiv - Neuroscience 2023Quote: ... pMXs-hs-3xHA-deltaRING-TRIM71 (Addgene, no. 52718), pMXs-hs-3xHA-delta Coiled Coil-TRIM71 (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... Lentiviral constructs for HMGA2 overexpression were obtained by sub cloning human HMGA2 from pMXS-hs-HMGA2 (Addgene, no. 52727) into pCDH-EF1a-eFFly-mCherry replacing eFFly using restriction enzymes XbaI and BamHI-HF ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 µl of AAV9.CAG.GCaMP6s.WPRE.SV40 or AAV9.syn.GCaMP8s-WPRE virus (Addgene, USA) was injected subcutaneously in the nape of the neck ...
-
bioRxiv - Neuroscience 2023Quote: ... SNCA KD and control plasmids (Zharikov et al., 2015), and Mito-PAGFP plasmid (Karbowski et al., 2004) were purchased from Addgene (plasmids 85131 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... a gift from Xiaokun Shu (Addgene plasmid # 106921). PCR amplification was typically conducted with ~20 overlapping DNA base primers and the PrimeSTAR HS DNA Polymerase (Clontech ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The KiMBI constructs were assembled in pcDNA3.1 vector (Addgene) behind the CAG promoter ...
-
bioRxiv - Synthetic Biology 2023Quote: ... DnaE intein plasmids were a gift from Hideo Iwai (Addgene plasmid #34549 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... DnaE intein plasmids were a gift from Hideo Iwai (Addgene plasmid #34549; http://n2t.net/addgene:34549; RRID:Addgene_3454936 and #15335; http://n2t.net/addgene:15335; RRID:Addgene_1533537). Cell lines HEK-293 ...
-
bioRxiv - Synthetic Biology 2023Quote: Plasmid pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from Feng Zhang (Addgene plasmid #6298832), pU6-sgGFP-NT1 was a gift from Stanley Qi & Jonathan Weissman (Addgene plasmid #46914 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... DnaE intein plasmids were a gift from Hideo Iwai (Addgene plasmid #34549; http://n2t.net/addgene:34549; RRID:Addgene_3454936 and #15335 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... AmCyan-P2A-mCherry was previously created by us34 (Addgene plasmid #45350 ...
-
bioRxiv - Physiology 2023Quote: ... HEK293T cells were transfected with P2X2R-YFP (Addgene plasmid #22400) by Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: Wild type (WT) and mutant variants of mouse p38γ were cloned into a pULTRA plasmid,42 a gift from Malcolm Moore (Addgene plasmid no ...
-
bioRxiv - Neuroscience 2023Quote: ... Connie Cepko (Addgene plasmid # 67634; http://n2t.net/addgene:67634; RRID:Addgene_67634). Expression of GFP was driven by the CMV promoter.
-
bioRxiv - Neuroscience 2023Quote: ... Connie Cepko (Addgene plasmid # 67634 ...
-
bioRxiv - Neuroscience 2023Quote: ... Bryan Roth (Addgene plasmid # 44362; http://n2t.net/addgene:44362; RRID:Addgene_44362). Expression of hM4Di-mCherry in Cre+ interneurons was driven by the neuronal Human synapsin 1 (hSyn ...
-
bioRxiv - Neuroscience 2023Quote: ... Bryan Roth (Addgene plasmid # 50459; http://n2t.net/addgene:50459; RRID:Addgene_50459). Expression of mCherry in Cre+ interneurons was driven by the neuronal hSyn promoter.
-
bioRxiv - Neuroscience 2023Quote: ... Bryan Roth (Addgene plasmid # 50476; http://n2t.net/addgene:50476; RRID:Addgene_50476). Expression of hM3Dq-mCherry in principal neurons was driven by the CaMK2α promoter.
-
bioRxiv - Neuroscience 2023Quote: ... Bryan Roth (Addgene plasmid # 50476 ...
-
bioRxiv - Neuroscience 2023Quote: ... A short guide RNA (sgRNA) was designed (GTCAAACCTGTCACCAGTTG) and cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene, #62988) according to a previously published protocol 31 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-TREtight-hM4Di-mCherry was generated by replacing the hM3Dq-mCherry of #66795 for hM4Di-mCherry from #50479 (Addgene plasmid, gift from Bryan Roth). Viral titer was 1 × 1013 genome copy (GC)/ mL ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2-hSyn-CREB-EGFP was constructed by substituting the CMV promoter for the hSyn from the AAV-CREB (Addgene plasmid #68550; gift from Eric Nestler), serotyped with AAV2 coat proteins and packaged at Viral Production Unit at the UPV ...
-
bioRxiv - Neuroscience 2023Quote: ... Wilson (Addgene plasmid # 105558; http://n2t.net/addgene:105558; RRID:Addgene_105558), and Cre-dependent GCaMP7s (Addgene# 104495-AAV1 ...
-
bioRxiv - Neuroscience 2023Quote: ... and Cre-dependent GCaMP7s (Addgene# 104495-AAV1) (123) ...
-
bioRxiv - Neuroscience 2023Quote: ... We thus co-infected AAVs expressing CamK2a-Cre (Addgene# 105558-AAV1), pENN.AAV.CamKII 0.4.Cre.SV40 was a gift from James M ...
-
bioRxiv - Cell Biology 2023Quote: ... the pGEX6P1-GFP plasmid (RRID:Addgene_61838) was transformed into BL21 (DE3 ...
-
bioRxiv - Cell Biology 2023Quote: ... EGFP-MISP sequence was subcloned into modified pFastBac-6xHis-MBP LIC expression vector (Addgene; plasmid #30116). In-frame sequence insertion was confirmed by sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... Both UL38 and mUL38 constructs were then cloned via Gibson assembly into a pLenti CMV/TO Puro plasmid (Addgene plasmid 22262) that was digested with BamHI and XbaI ...
-
bioRxiv - Genomics 2023Quote: ... We assembled the Smarca4-mAID targeting vector by a serial modification of the base vectors pMK287 (mAID-Hygro, Addgene #72825) and pL45218 ...
-
bioRxiv - Genomics 2023Quote: We assembled the CRISPR/Cas9 vectors by annealing pairs of oligos carrying the sgRNA sequences and cloning them into pSpCas9(BB)-2A-Puro (PX459) (Addgene #62988) as described60 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV.CAG.Flex.GCaMP6s.WPRE.SV40 (Addgene #100842) was used as a PCR template to subclone the GCaMP6s cassette ...
-
bioRxiv - Biochemistry 2023Quote: ... sapiens SUV39H2 catalytic subunit (Addgene plasmid #25115) Escherichia coli expression plasmids used in this study were acquired from Addgene ...
-
bioRxiv - Biochemistry 2023Quote: ... Escherichia coli expression plasmids used in this study were acquired from Addgene, made possible through a gift by Cheryl Arrowsmith ...
-
bioRxiv - Biochemistry 2023Quote: ... All remaining histone methyltransferase expression plasmids were generated for this study and will be made freely available from Addgene. HMT amino acids included in expression plasmids are as follows ...
-
bioRxiv - Biochemistry 2023Quote: The Homo sapiens EHMT1 catalytic subunit (Addgene plasmid #51314) and H ...
-
bioRxiv - Cancer Biology 2023Quote: ... the following guide sequences were cloned into the lentiCRISPR vector (Addgene plasmid #52961 – deposited by the Zhang lab 19):
-
bioRxiv - Cell Biology 2023Quote: ... Belousov (Addgene plasmid # 136468).
-
bioRxiv - Immunology 2023Quote: pBABE-mRIPK3 was acquired from Addgene (pBabe-puro-mRipk3 ...
-
bioRxiv - Cell Biology 2023Quote: PCR products from plasmids GFP-AHPH-WT (a gift from Michael Glotzer, Addgene plasmid # 68026) and GFP-AHPH-DM (a gift from Alpha Yap ...
-
bioRxiv - Cell Biology 2023Quote: ... and GFP-AHPH-DM (a gift from Alpha Yap, Addgene plasmid # 71368) were subcloned using following primers to create Gateway attB PCR products ...
-
bioRxiv - Cancer Biology 2023Quote: ... targeting exon 6 and exon 9 of human ATRX or mouse Atrx (Supplementary Table 1) were cloned into CRISPR-Cas9 lentiCRISPR v2 vector (gift from Feng Zhang, Addgene plasmid #52961). Lentivirus was produced in 293FT cells ...
-
bioRxiv - Cell Biology 2023Quote: ... lentiGuide-puro was a gift from Feng Zhang (Addgene plasmid #52963). pFUGW-EFSp-Cas9-P2A-Zeo (pAWp30 ...
-
bioRxiv - Cancer Biology 2023Quote: ... we transfected Cos7 cells with Cx43-GFP (gift from David Spray (Addgene plasmid #69007 ...
-
bioRxiv - Cell Biology 2023Quote: ... pCMV-VSV-G was a gift from Bob Weinberg (Addgene plasmid #8454). lentiCRISPRv2puro was a gift from Brett Stringer (Addgene plasmid #98290) ...
-
bioRxiv - Cell Biology 2023Quote: ... pLKO.1 hygro was a gift from Bob Weinberg (Addgene plasmid # 24150) Other vectors generated during this study are available upon request.
-
bioRxiv - Cell Biology 2023Quote: ... psPAX2 was a gift from Didier Trono (Addgene plasmid # 12260). pCMV-VSV-G was a gift from Bob Weinberg (Addgene plasmid #8454) ...
-
bioRxiv - Neuroscience 2023Quote: ... Cre-dependent AAV encoding GCaMP6s (AAV9 CAG-FLEx-GCaMPs-WPRE-SV40, 1.5 × 1013 gp/ml; Addgene, #100842-AAV9) was injected into the ARC using the following coordinates from the bregma ...