Labshake search
Citations for Addgene :
6801 - 6850 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... pORTMAGE-Ec1 was generated previously (Addgene plasmid no. 138474)27 ...
-
bioRxiv - Bioengineering 2023Quote: ... The genetic constructs were subcloned into the pET 6xHis TEV cloning vector (Addgene #29653) using standard restriction and ligation cloning procedures ...
-
bioRxiv - Bioengineering 2023Quote: ... The assembled fragment was sandwiched by two Smn1 intron 1 gRNA target sequence and subcloned into between ITRs of PX552 purchased from Addgene (Addgene 60958), and generated pAAV-SMN1-HITI ...
-
bioRxiv - Biochemistry 2023Quote: ... GST–TEV–FUS (Addgene, Plasmid #29629), pDEST_TAF15 (Addgene ...
-
bioRxiv - Microbiology 2023Quote: ... a gift from Chandra Tucker (Addgene plasmid # 60032 ...
-
bioRxiv - Microbiology 2023Quote: ... Douglas Black (Addgene plasmid # 23026 ...
-
bioRxiv - Microbiology 2023Quote: ... a gift from Chandra Tucker (Addgene plasmid # 60032; http://n2t.net/addgene:60032 ; RRID:Addgene_60032) [68] ...
-
bioRxiv - Cell Biology 2023Quote: ... The pK19pA-MN plasmid was a gift from Steven Henikoff (Addgene plasmid #123461; http://n2t.net/addgene:123461; RRID:Addgene_123461). An NLS sequence was introduced into this plasmid before the stop codon using Gibson assembly cloning to generate pK19pA-MN-NLS (pDL125) ...
-
bioRxiv - Cell Biology 2023Quote: His-tagged Set9 protein expression was induced overnight at room temperature with 1 mM IPTG using BL21(DE3) Escherichia coli transformed with pET28 Set9 plasmid (Addgene plasmid #24082). Cells were pelleted at 7000 rpm for 20 minutes at 4°C using rotor JA-10 ...
-
bioRxiv - Cell Biology 2023Quote: ... Anti-mCherry GST-tagged nanobodies (Addgene #70696, (Katoh et al, 2016)) were expressed and purified according to published protocol (Katoh et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... The mCherry-Cry2 constructs were made by amplifying mCherry-Cry2 DNA from Addgene plasmid #101221 (gift from Brangwynne) ...
-
bioRxiv - Cell Biology 2023Quote: ... pLJC5-3XHA-EGFP-PEX26 (Addgene, 139054) was cut with AgeI (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... mCherry-SEC61β was PCR amplified from mCh-Sec61 beta (a gift from Gia Voeltz (Addgene plasmid, 49155; http://n2t.net/addgene:49155; RRID:Addgene 49155)) with primers ATGGTGAGCAAGGGCGAGGA and TTACCCTGTCTTATTGCTAAATGGAACGTAAAAGTTAGGACCCGAACGAGTGTAC TTGCCCCAAATGTG ...
-
bioRxiv - Neuroscience 2023Quote: ... Nathan Shaner and Roger Tsien (Addgene plasmid #54642) [72].
-
bioRxiv - Neuroscience 2023Quote: ... pAAV-hSyn-Cre-P2A-dTomato was a gift from Rylan Larsen (Addgene viral prep # 107738-AAVrg ...
-
bioRxiv - Molecular Biology 2023Quote: ... was purchased from Addgene (#82475). The pcDNA4/TO-bio-myc-mCE construct was prepared by sub-cloning the bio-myc-mCE sequence into an empty pcDNA4/TO vector using KpnI and ApaI restriction sites ...
-
bioRxiv - Molecular Biology 2023Quote: ... rtTA was amplified from the LT3GEPIR vector (Addgene: 111177) and cloned into the backbone using NEB HiFi assembly.
-
bioRxiv - Molecular Biology 2023Quote: ... pL1P2OsUbiP:Cas9:NosT (Addgene #165424), pL1P5ZmUbiP:GRF-GIF:NosT
-
bioRxiv - Microbiology 2023Quote: ... sgRNA/Cas9 cloning vector pX459-mCherry (Addgene, #64324), the pIRES2-EGFP-p53 WT Plasmid (Addgene ...
-
bioRxiv - Microbiology 2023Quote: ... and CoV2-N-WT-Hu1 (Addgene plasmid # 177937) plasmids were a gift from Jennifer Doudna [52] ...
-
bioRxiv - Genomics 2023Quote: ... The sgRNA oligos were annealed and cloned into the CROP-seq-opti plasmid (Addgene, #106280) after BsmBI (NEB ...
-
bioRxiv - Genetics 2023Quote: pDESTsplice (Addgene #32484) splicing reporter plasmids containing the entire exonic and intronic DNA sequence spanning SCN1A exons 20 to 21 (including 20N ...
-
bioRxiv - Genetics 2023Quote: ... and the pU6 (BbsI)_CBh-Cas9-T2A-mCherry (Addgene, #64324) vectors ...
-
bioRxiv - Neuroscience 2023Quote: We delivered AAV-PHP.eB-CAG-nls-GFP (Addgene, 104061-PHPeB) and AAV-PHP.S-CAG-tdTomato (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... Cre-dependent stGtACR2-FusionRed under the hSyn1 promoter (#105677, Addgene) and the cytosolic reporter tandem tomato (tdTomato ...
-
bioRxiv - Neuroscience 2023Quote: ... used for M1 knockdown was designed with the TRC algorithm (Broad Institute) and cloned into the pAAV-shRNA-ctrl vector from Addgene. pAAV-shRNA-ctrl was used as the empty vector plasmid in Figure 5 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were cloned into the transposon vector PT4-CMV-GFP (Addgene #117046) and amplified as described in90 ...
-
bioRxiv - Developmental Biology 2023Quote: Individual LARRY barcode constructs were cloned from the LARRY barcode library (Addgene:140024) 89 and transfected to 293T cells to generate lentivirus ...
-
bioRxiv - Neuroscience 2023Quote: ... 50ng of pGGDestTol2LC-3sgRNA (Addgene #64241) was combined with 100 ng of each pU6:sgRNA vector generated above ...
-
bioRxiv - Neuroscience 2023Quote: ... Chimeric G proteins for the Gsx assay 44 were obtained from Addgene (Watertown, MA, USA).
-
bioRxiv - Neuroscience 2023Quote: ... A control vector lacking the hM4Di receptor was also used (AAV8-CaMKII-EGFP; 2.1 x 1013 gc/ml Addgene viral prep # 50469-AAV8 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... GFP and mCherry-responsive synNotch construction: pHR_SFFV_myc- LaG17_synNotch_TetRVP64 (Addgene plasmid# 79128) and pHR_EF1a_flag- LaM4_synNotch_Gal4-VP64 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pHR_5x Gal4 UAS (Addgene plasmid# 79119), mouse MyoD (NP_034996.2) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... built from pHR_EF1a_flag-LaM4_synNotch_TetRVP64 (Addgene plasmid#162237) and HR_pGK_LaG17_synNotch_Gal4VP64 (Addgene plasmid# 79127) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and pMD2.G (Addgene plasmid #12259). MDA-MB-231 and MDA-MB-436 cells were transduced 48-72 h post-HEK293T transfection with Tet-pLKO-puro lentiviruses containing shRNAs targeting human KIF5B (TRCN0000338580 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 17 as a template and inserted into pXR002: EF1a-dCasRx-2A-EGFP (a gift from Patrick Hsu; Addgene plasmid #109050 ...
-
bioRxiv - Molecular Biology 2023Quote: ... lipofection with Tet-pLKO-puro (Addgene plasmid #21915) shRNA containing lentiviral constructs or a scrambled lentivrial construct (Addgene plasmid #162011 ...
-
bioRxiv - Molecular Biology 2023Quote: ... H133A/H1058A (a gift from Feng Zhang; Addgene plasmid #103865 ...
-
bioRxiv - Molecular Biology 2023Quote: ... using pC0045-EF1a-PguCas13b-NES-HIV (a gift from Feng Zhang; Addgene plasmid #103861; http://n2t.net/addgene:103861; RRID: Addgene_103861) 18 as a template and inserted into pXR002 ...
-
bioRxiv - Neuroscience 2023Quote: ... 2014) AAV2-hSyn-DIO-hM4D(Gi)- mCherry vector (titer ≥ 5×10¹² vg/mL) was attained from AddGene (catalog number 44362-AAV2). Rats were anesthetized with 2.5% isoflurane ...
-
bioRxiv - Systems Biology 2023Quote: ... and pMW#3 (Addgene #13350) destination vectors using LR Clonase (ThermoFisher) ...
-
bioRxiv - Systems Biology 2023Quote: ... and to amplify the fluorescent proteins from plasmids (SYFP2 from pSYFP2-C1 Addgene #22878 ...
-
bioRxiv - Synthetic Biology 2023Quote: - “Px-mCerulean-pA” (Addgene ID 202048) - contains a cloning site in place of the promoter so that targeting arrays can be introduced upstream of the mCerulean reporter gene ...
-
bioRxiv - Synthetic Biology 2023Quote: ... terminator from Agrobacterium tumefaciens nopaline synthase (tNOS, Addgene ID 194997) and markers ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pcDNA3.1_Signal-Flag-DRD2 was generated by PCR amplifying the DRD2 CDS from DRD2-Tango (Addgene #66269) (introducing a stop codon ...
-
bioRxiv - Neuroscience 2023Quote: ... the coding sequence of SpCas9n (Streptococcus pyogenes Cas9) was obtained from pX335 (Addgene #42335) and subcloned into a AAV backbone under the MeCP2 promoter as in [45] ...
-
bioRxiv - Neuroscience 2023Quote: ... and p3E_he1a:ECFP (Addgene, #113880) into a Tol2 Destination Vector (69 ...
-
bioRxiv - Neuroscience 2023Quote: ... Gateway reactions were used to introduce either p5E_elavl3 or p5E_nbt with pME_hGCGR*-TEVcs-QF and p3E_he1a:ECFP (Addgene #113880) into the Tol2 Gateway Destination Vector (69 ...
-
bioRxiv - Cell Biology 2023Quote: ... GFP-rGBD was purchased from Addgene (Cat #26732).
-
bioRxiv - Genetics 2023Quote: ... 400 ng of VSV-G (Addgene #8454), and 1100 ng of PAX2 (Addgene #12260 ...