Labshake search
Citations for Addgene :
6751 - 6800 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... pUC19 - T7 pro - IRES - EGFP was a gift from Fei Chen (Addgene plasmid # 138586 ...
-
bioRxiv - Microbiology 2023Quote: ... The backbone vector pLVX-EF1alpha-2xStrep-IRES-Puro was linearized by PCR from Addgene plasmid # 141395 with primers pLVX-EF1alpha_Fw (ctcgaaggcggcggg ...
-
bioRxiv - Microbiology 2023Quote: ... The codon-optimized HCoV-OC43 N sequence was amplified from plasmid # 151960 (Addgene) with primers HCoV-OC43-N c-opt(pLVX)_Fw (gaattcgccgccaccatgtccttcaccccggg ...
-
bioRxiv - Microbiology 2023Quote: Plasmid pLVX-EF1alpha-eGFP-2xStrep-IRES-Puro encoding eGFP was obtained from Addgene (# 141395). The codon-optimized HCoV-OC43 N sequence was amplified from plasmid # 151960 (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... pCMV6-AN-DDK-Fam122a was generated using SgfI/MluI restriction sites from the precision shuttle system (pCMV6-AN-DDK-Pol Iota-A kind gift from Roger Woodgate Addgene #131228). pCMV6-AN-mGFP and pCMV6-AN-mRFP plasmids were kind gifts from Richard Katz with Fam122a inserted using SgfI/MluI restriction sites ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were first transduced with the Cas9 expression vector pHRSIN-PSFFV-Cas9-PPGK-Blasticidin73 or FUCas9Cherry (a gift from Marco Herold, Addgene #70182)74 ...
-
bioRxiv - Molecular Biology 2023Quote: ... WT and T1150A catalytic domains tagged with nuclear localization sequence (NLS) of the SV40 Large T-antigen were cloned into the mVenus-C1 plasmid backbone (provided by Steven Vogel, Addgene plasmids no. 27794) (Koushik et al. ...
-
bioRxiv - Molecular Biology 2023Quote: Single guide RNA (sgRNA) oligonucleotides (Integrated DNA Technologies) were cloned into lentiviral expression vectors pKLV-U6gRNA(BbsI)-PGKpuro2ABFP (Addgene #50946, a gift from Kosuke Yusa)67 as described ...
-
bioRxiv - Molecular Biology 2023Quote: ... which encodes puromycin and BFP selection markers obtained from Addgene #50946 ...
-
bioRxiv - Molecular Biology 2023Quote: ... these double stranded oligonucleotides were ligated with pU6-(BbsI)_CBh-Cas9-T2A-mCherry plasmid backbone (provided by Ralf Kuehn, Addgene catalog number 64324) (Chu et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... pcDNA5-FRT-TO-EGFP-AID was a gift from Andrew Holland (Addgene plasmid # 80075 ...
-
bioRxiv - Molecular Biology 2023Quote: ... pMSCVpuro-DEST was a gift from Andrew Jackson & Martin Reijns (Addgene plasmid # 119745 ...
-
bioRxiv - Molecular Biology 2023Quote: ... pMSCVpuro-DEST was a gift from Andrew Jackson & Martin Reijns (Addgene plasmid # 119745; http://n2t.net/addgene:119745; RRID:Addgene_119745). ppyCAG_RNaseH1_WT was a gift from Xiang-Dong Fu (Addgene plasmid# 111906 ...
-
bioRxiv - Molecular Biology 2023Quote: ... pX330-U6-Chimeric_BB-CBh-hSpCas9 was a gift from Feng Zhang (Addgene plasmid # 42230 ...
-
bioRxiv - Molecular Biology 2023Quote: ... pLVpuro-CMV-N-EGFP was a gift from Robin Ketteler (Addgene plasmid # 122848 ...
-
bioRxiv - Molecular Biology 2023Quote: ... MLM3636 was a gift from Keith Joung (Addgene plasmid # 43860 ...
-
bioRxiv - Molecular Biology 2023Quote: ... ppyCAG_RNaseH1_D210N was a gift from Xiang-Dong Fu (Addgene plasmid # 111904 ...
-
bioRxiv - Molecular Biology 2023Quote: ... pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from Feng Zhang (Addgene plasmid # 62988; http://n2t.net/addgene:62988; RRID:Addgene_62988). pMSCV_PM_shRNA_Control_puro was a gift from Steve Elledge48 ...
-
bioRxiv - Molecular Biology 2023Quote: ... pLVpuro-CMV-N-EGFP was a gift from Robin Ketteler (Addgene plasmid # 122848; http://n2t.net/addgene:122848 ; RRID:Addgene_122848). pSpCas9(BB)-2A-Puro (PX459 ...
-
bioRxiv - Molecular Biology 2023Quote: ... ppyCAG_RNaseH1_WT was a gift from Xiang-Dong Fu (Addgene plasmid# 111906 ...
-
bioRxiv - Molecular Biology 2023Quote: ... psPAX2 was a gift from Didier Trono (Addgene plasmid # 12260 ; http://n2t.net/addgene:12260 ; RRID:Addgene_12260). pLVpuro-CMV-N-EGFP was a gift from Robin Ketteler (Addgene plasmid # 122848 ...
-
bioRxiv - Molecular Biology 2023Quote: ... pGEX6P1-hsRNASEH2BCA was a gift from Andrew Jackson & Martin Reijns (Addgene plasmid # 108692; http://n2t.net/addgene:108692; RRID:Addgene_108692). pMD2.G was a gift from Didier Trono (Addgene plasmid # 12259 ...
-
bioRxiv - Molecular Biology 2023Quote: pEGFP-RNASEH2B was a gift from Andrew Jackson & Martin Reijns (Addgene plasmid # 108697; http://n2t.net/addgene:108697; RRID:Addgene_108697). pMSCVpuro-DEST was a gift from Andrew Jackson & Martin Reijns (Addgene plasmid # 119745 ...
-
bioRxiv - Molecular Biology 2023Quote: ... pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from Feng Zhang (Addgene plasmid # 62988 ...
-
bioRxiv - Microbiology 2023Quote: Plasmids for Sleeping Beauty transposition included pCMV(CAT)T7-SB100 (Addgene 34879) and an ISG54 promoter driving Nluc-2A-GFP cloned into the pSBbi-BB backbone (Addgene 60521).
-
bioRxiv - Microbiology 2023Quote: The human SAM CRISPRa sgRNA library (Addgene #1000000078) was cloned into the pHW-TRPPC-NS rescue plasmid backbone for PR8 (Fig S2A ...
-
bioRxiv - Microbiology 2023Quote: ... the gene was amplified and inserted into an expression vector backbone pCW-lic (Addgene, 26908). A polymerase chain reaction (PCR ...
-
bioRxiv - Molecular Biology 2023Quote: ... YFP NLS Beta-Actin S14C and YFP NLS Beta-Actin G13R were a gift from Primal de Lanerolle (Addgene plasmid # 60613; http://n2t.net/addgene:60613; RRID:Addgene_60613 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primary fibroblasts were immortalized with 293FT (Invitrogen)-derived supernatant containing a human telomerase reverse transcriptase (TERT) lentivirus that was generated with the plasmids pLV-hTERT-IRES-hygro (gift from Tobias Meyer; Addgene #85140)(24) ...
-
bioRxiv - Neuroscience 2023Quote: ... Cre-dependent mCherry under the human synapsin promoter in dHPC (AAV5-hSyn-DIO-mCherry, titer: 1.1 × 1013 vg/ml, Catalog #50459-AAV5, Addgene, Watertown, USA). For optogenetic experiments ...
-
bioRxiv - Molecular Biology 2023Quote: ... 11.4 μg pMDLg-RRE (#12251, Addgene), 5.4 μg pRSV-REV (#12253 ...
-
bioRxiv - Molecular Biology 2023Quote: ... the transfection mixture was prepared by combining lentiviral packaging plasmids 7.5 μg pMD2.G (#12259, Addgene), 11.4 μg pMDLg-RRE (#12251 ...
-
bioRxiv - Molecular Biology 2023Quote: ... YFP NLS Beta-Actin S14C and YFP NLS Beta-Actin G13R were a gift from Primal de Lanerolle (Addgene plasmid # 60613; http://n2t.net/addgene:60613; RRID:Addgene_60613; Addgene plasmid # 60614 ...
-
bioRxiv - Microbiology 2023Quote: ... The pUCmini-iCAP-PHP.eB was a gift from Viviana Gradinaru (Addgene plasmid # 103005 ...
-
bioRxiv - Microbiology 2023Quote: ... and pBTK401 (Type 8) (Addgene_65109, Addgene_183127, Addgene_65179 ...
-
bioRxiv - Microbiology 2023Quote: ... and pBTK401 (Type 8) (Addgene_65109, Addgene_183127, Addgene_65179, Addgene_183126, Addgene_110593, Addgene_110597), and dsRNA target sequence (Type 3 ...
-
bioRxiv - Microbiology 2023Quote: ... we constructed CRISPR/Cas9 plasmids using the LentiCRISPRv2-puro vector (Addgene #98290) (61 ...
-
bioRxiv - Microbiology 2023Quote: ... 0.5 μg pVSV-G (Addgene #8454), and 2.3 μg psPAX2 (Addgene #12260 ...
-
bioRxiv - Microbiology 2023Quote: ... were purchased from Addgene and transfected into HEK293T cells together with pSPAX2 (Addgene, cat. 12260) and VSV-G DNA (Addgene ...
-
bioRxiv - Microbiology 2023Quote: ... and VSV-G DNA (Addgene, cat. 8454) (24 ...
-
bioRxiv - Microbiology 2023Quote: ... Keith Joung (Addgene plasmids #43861 and #43860) as detailed elsewhere (Muller et al. ...
-
bioRxiv - Microbiology 2023Quote: ... a gift from William Hahn & David Root (Addgene plasmid # 23944 ...
-
bioRxiv - Microbiology 2023Quote: ... a gift from William Hahn & David Root (Addgene plasmid # 23944; http://n2t.net/addgene:23944; RRID: Addgene_23944). The amplicon was cloned into the pcDNA3.1 V5-His-TOPO vector to generate the pEQ1797 plasmid ...
-
bioRxiv - Microbiology 2023Quote: ... and ligated with the pGOAL (Addgene, #20190) gene marker cassette by overnight ligation at 4 °C with T4 DNA Ligase (NEB) ...
-
bioRxiv - Microbiology 2023Quote: ... cerevisiae BY4741 as described in the methods of Bao.10 The pCRCT plasmid was a gift from Huimin Zhao (Addgene plasmid # 60621; http://n2t.net/addgene:60621; RRID: Addgene_60621) and purchased from Sigma.
-
bioRxiv - Microbiology 2023Quote: ... cerevisiae BY4741 as described in the methods of Bao.10 The pCRCT plasmid was a gift from Huimin Zhao (Addgene plasmid # 60621 ...
-
bioRxiv - Microbiology 2023Quote: ... An inducible GFP was made by inserting the Yersinia operon 1 promoter sequence into plasmid pFCcGi (Addgene) upon restriction with HindIII and XbaI (NEB) ...
-
bioRxiv - Microbiology 2023Quote: HEK293 cells expressing transiently-transfected actin fused to monomeric azure-fluorescent protein (mAzure-Actin; Addgene) were grown on coverslips in 12-well plates at 2×105 cells/well and infected with Bp340 ...
-
bioRxiv - Microbiology 2023Quote: ... pEZYegfp (Addgene). To create a Gateway® destination vector for use in translocation assays (pJC125DEST) ...
-
bioRxiv - Immunology 2023Quote: ... we utilized a CRISPR-based strategy using LentiCRISPRv2 plasmid (#52961, Addgene) as described previously[46] ...