Labshake search
Citations for Addgene :
801 - 850 of 10000+ citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviral particles were produced in HEK293T cells using packaging and envelope constructs pCMVΔ8.2 and pMD.G-VSV-G (pCMVΔ8.2 and pMD.G-VSV-G were gifts from Bob Weinberg, Addgene plasmids #8454, #8455), and concentrated using fast-trap virus purification and concentration kit according to manufacturer′s instructions (Millipore) ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV5-Syn-FLEX-ChrimsonR-tdT (Addgene: 62723-AAV5), AAV9-EF1a-DIO-HA-SNAP-mGluR2-WPRE was previously reported.45,48 PORTL compound BGAG12,400 was synthesized by J ...
-
bioRxiv - Neuroscience 2024Quote: Control EGFP (pAAV.GfaABC1D.PI.Lck-GFP.SV40; #105598-AAV5) and tdTomato (pZac2.1 gfaABC1D-tdTomato; #44332-AAV5) viruses were purchased from Addgene [47] ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV5-pCAG-FLEX-EGFP (Addgene: 51502-AAV5), AAV9-EF1a-dfloxed-hChR2-EYFP (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... AAVrg-CAG-GFP (Addgene: 37825-AAVrg), AAV5-pCAG-FLEX-EGFP (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... and the AAV9 hM3D DREADD (AAV-hSyn-DIO-hM4D(Gq)-mCherry) (titer = 4.5 × 1012 vg/mL; Addgene; 44361-AAV9) was stereotaxically injected into the OV/MEPO of Nos1-cre female and male mice ...
-
bioRxiv - Neuroscience 2024Quote: ... The following AAVs were used: AAVrg-CAG-FLEX-tdTomato (Addgene 59462-AAVrg), AAVrg-CAG-GFP (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... and psPAX2 (Addgene #12260). LNCaP and LAPC4 Cas9 expressing cells were infected with lentiviral particles and treated with 1 µg/mL doxycycline to induce cas9 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV9-EF1a-dfloxed-hChR2-EYFP (Addgene: 20298-AAV9), AAV5-Syn-FLEX-ChrimsonR-tdT (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: All adeno-associated viruses (AAVs) were purchased from Addgene or custom-synthesized by the University of Pennsylvania vector core ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-hSyn-DIO-hM3D(Gq)mCherry (Addgene viral prep # 44361-AAV5 ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-hSyn-DIO-hM3D(Gq)mCherry (Addgene viral prep # 44361-AAV5 ; http://n2t.net/addgene:44361; RRID:Addgene_44361)35 ...
-
bioRxiv - Neuroscience 2024Quote: ... or pAAV-hSyn-DIO-hM4D(Gi)-mCherry (Addgene viral prep # 44362AAV5; http://n2t.net/addgene:44362; RRID:Addgene_44362)35 was injected into the claustrum (200 nl).
-
bioRxiv - Neuroscience 2024Quote: ... Mito-RFP tracker (Plasmid #51013) was from Addgene (pLenti.CAG.H2B-cerFP-2A-mito-dsRFP.W). Viafluor-488 live cell microtubule staining kit (Biotium ...
-
bioRxiv - Neuroscience 2024Quote: ... or pAAV-hSyn-DIO-hM4D(Gi)-mCherry (Addgene viral prep # 44362AAV5 ...
-
bioRxiv - Neuroscience 2024Quote: ... pGP-AAV-syn-FLEX-jGCaMP7f-WPRE (Addgene viral prep # 104492-AAV1; http://n2t.net/addgene:104492; RRID:Addgene_104492)34 ...
-
bioRxiv - Neuroscience 2024Quote: ... pGP-AAV-syn-FLEX-jGCaMP7f-WPRE (Addgene viral prep # 104492-AAV1 ...
-
bioRxiv - Systems Biology 2024Quote: ... and ligating into pEN_TTmcs (Addgene, 25755) (107 ...
-
bioRxiv - Systems Biology 2024Quote: ... pSLIK CVB3 A67G hygro was prepared by Gateway recombination of pEN_TT CVB3 A67G (Addgene, 216788) and pSLIK hygro (Addgene ...
-
bioRxiv - Systems Biology 2024Quote: ... and pSLIK hygro (Addgene, 25737) (107 ...
-
bioRxiv - Neuroscience 2024Quote: ... Diluted 500 nl of AAV1-CAG-Flex-GCaMP6s-WPRE-SV40 (Addgene # 100842) and AAV9-syn-5HT3.5 (WZ Biosciences ...
-
bioRxiv - Neuroscience 2024Quote: mTagBFP (Addgene #89685), FAT-1 (Genscript) ...
-
bioRxiv - Neuroscience 2024Quote: Adeno-associated virus (AAV) type 2 carrying cre-dependent ChR2-eYFP (Addgene plasmid 20298 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and PH(Akt)-Venus (a gift from Narasimhan Gautam, Addgene plasmid #85223; http://n2t.net/addgene:85223; RRID:Addgene_85223) (O’Neill and Gautam ...
-
bioRxiv - Molecular Biology 2024Quote: ... along with envelope plasmid (pMD2.G) (Addgene, Cat# 12259), and packaging plasmid (psPAX2 ...
-
bioRxiv - Neuroscience 2024Quote: ... cultures in both chambers were infected with the genetically encoded calcium indicator (GECI) (AAV9.Syn.GCaMP6s.WPRE.SV40, Addgene) after 4 DIV ...
-
bioRxiv - Plant Biology 2024Quote: ... the PEE392 plasmid (Addgene #149282, www.addgene.org) was used as a template to amplify a guide RNA fragment ...
-
bioRxiv - Cell Biology 2024Quote: alix and tsg101 were amplifed from cDNA using the Bio-Rad iScript kit and cloned into pJC53.2 (RRID:Addgene_26536) as previously described26 ...
-
bioRxiv - Cell Biology 2024Quote: Transfection experiments were done with human WT PCMVHA hEZH2 plasmid (#24230, Addgene), a kind gift from Dr ...
-
bioRxiv - Neuroscience 2024Quote: The following commercial viruses were produced by AddGene: rAAVretro-EF1a-Cre (2.1 x 1013 vg/ml ...
-
bioRxiv - Neuroscience 2024Quote: The coding sequences for Kir2.1-T2A-tdTomato and mutKir2.1-T2A-tdTomato (gifts from Massimo Scanziani, Addgene #60661 and #60644, respectively) were subcloned into an hSyn-DIO backbone ...
-
bioRxiv - Neuroscience 2024Quote: ... psPAX2 (Addgene plasmid #12260; http://n2t.net/addgene:12260; RRID:Addgene_12260) and pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Neuroscience 2024Quote: The shRNA construct for mouse aldolase A was generated using oligos directed towards the 3’UTR of Aldoa (GCCCACTGCCAATAAACAACT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) and cloned into the pLKO.1 cloning vector (Addgene Cat# 10878, RRID:Addgene_10878) and pCGLH vector for lentivirus and in utero electroporation experiments ...
-
bioRxiv - Neuroscience 2024Quote: The shRNA construct for mouse aldolase A was generated using oligos directed towards the 3’UTR of Aldoa (GCCCACTGCCAATAAACAACT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) and cloned into the pLKO.1 cloning vector (Addgene Cat# 10878, RRID:Addgene_10878) and pCGLH vector for lentivirus and in utero electroporation experiments ...
-
bioRxiv - Neuroscience 2024Quote: ... and VSV-G (Addgene #12259) lentiviral packaging plasmids with Lipofectamine 3000 Transfection Reagent (Invitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNAs were amplified with PCR and subcloned into the pHR-hSyn-EGFP vector (Addgene #114215) along with a T2A-NLS-mApple minigene for fluorescent visualization ...
-
bioRxiv - Systems Biology 2024Quote: ... Cas9-positive cells were infected with lentiGuide-Puro (Addgene 52963) inserted with sgRNA ...
-
bioRxiv - Systems Biology 2024Quote: ... psPAX2 (#12260) and pCMV-VSVG (#8454) were obtained from Addgene.
-
bioRxiv - Neuroscience 2024Quote: ... cells were transfected with either (G4C2)92 and (G4C2)2 lentiviral transfer plasmids along with PAX (Addgene #12260) and VSV-G (Addgene #12259 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and ABE 7.1050 (Addgene #102919) into a piggyBac plasmid51 with neomycin resistance ...
-
bioRxiv - Neuroscience 2024Quote: ... and pMD2.G (Addgene plasmid #12259; http://n2t.net/addgene:12259 RRID:Addgene_12259) were gifts from Didier Trono ...
-
bioRxiv - Neuroscience 2024Quote: ... and pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Cancer Biology 2024Quote: ... HEK293T cells were co-transfected with a lentiCRISPRv2 plasmid (Addgene #52961) containing each sgRNA sequence (see below) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the envelope plasmid pMD2.G (Addgene #12259), using the X-tremeGENE HP DNA Transfection Reagent (Roche) ...
-
bioRxiv - Cancer Biology 2024Quote: ... the second-generation packaging plasmid psPAX2 (Addgene #12260), and the envelope plasmid pMD2.G (Addgene #12259) ...
-
bioRxiv - Cancer Biology 2024Quote: ... The p53-GFP backbone was purchased from Addgene (11770) (p53-GFP was a gift from Geoff Wahl (Addgene plasmid #11770)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... (shp53 pLKO.1 puro was a gift from Bob Weinberg (Addgene plasmid # 19119 ; http://n2t.net/addgene:19119 ; RRID:Addgene_19119)) [46].
-
bioRxiv - Cancer Biology 2024Quote: ... The p53-GFP backbone was purchased from Addgene (11770) (p53-GFP was a gift from Geoff Wahl (Addgene plasmid #11770)) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... HEK-293 cells were transfected with two plasmid vectors CMV–R-GECO1 (a gift from Robert Campbell, Addgene plasmid #32444 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and pJWV102-PL-dCas9 (Addgene plasmid # 85588) donated by Jan-Willem Veening (40).