Labshake search
Citations for Addgene :
801 - 850 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... a hNav1.5 plasmid (Addgene plasmid #145374 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: The CLYBL-targeting pC13N-iCAG.copGFP vector (Addgene #66578) [66] was used as a backbone to generate three constructs encoding different N-terminal-HiBiT-GBA1 variants (WT ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... along with left and right TALENs (pZT-C13-L1: Addgene #62196; pZT-C13-R1: Addgene #62197; 375 ng/well each) targeting the human Citrate Lyase Beta-Like (CLYBL ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... along with left and right TALENs (pZT-C13-L1: Addgene #62196 ...
-
bioRxiv - Physiology 2024Quote: ... or pcDNA3.1-PPARgamma2 (#78768, Addgene, Watertown, MA, USA) plasmids using Lipofectamine 3000 (ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2024Quote: ... were obtained from Addgene. pAAV7-DJ-CMV-TeNT-P2A-GFP was prepared and obtained through the Stanford Viral Core ...
-
bioRxiv - Physiology 2024Quote: pAAV-hSyn-mCherry (Addgene #114472-AAV8) and pAAV-hSyn-hM3D(Gq)-mCherry (Addgene #50474-AAV8 ...
-
bioRxiv - Physiology 2024Quote: ... and pAAV-hSyn-hM3D(Gq)-mCherry (Addgene #50474-AAV8) were obtained from Addgene ...
-
bioRxiv - Physiology 2024Quote: ... Repair templates in pDD282 (Addgene 66823) (forward primer for upstream arm ...
-
bioRxiv - Neuroscience 2024Quote: ... pSPAX2 and pMD2.G (Addgene plasmids 12260 and 12259, respectively) were transfected using Lipofectamine 3000 (ThermoFisher ...
-
bioRxiv - Plant Biology 2024Quote: ... together with a fragment containing the nucleotides encoding for the Pip1 pro-domain but lacking the signal peptide (pJK110; Supplemental Table S4) were combined in all 64 possible combinations with pICH41264 (Addgene #4799; Weber et al., 2011) in a BpiI Golden Gate reaction (Supplemental Table S4) ...
-
bioRxiv - Neuroscience 2024Quote: ... or a Cre-dependent GtACR2 (pAAV1-hSyn1-SIO-stGtACR2-FusionRed, Addgene #105677) into each burr hole approximately 0.5 mm below the pial surface with an injection rate of 10-20 nl/min ...
-
bioRxiv - Pathology 2024Quote: ... (WT and variants) with a mTurquoise (mTq2) tag on the C-terminus were cloned into a pSBtet-pur vector (Addgene) using SfiI sites ...
-
bioRxiv - Neuroscience 2024Quote: ... and Rab10T23N were purchased from Addgene (ER-GCaMP6-150 ...
-
bioRxiv - Neuroscience 2024Quote: ... and then 500 nL of AAV1-hSyn-GCaMP6s-WPRE-SV40 (Addgene: 100843-AAV1) was injected at a rate of 5 nL/second ...
-
bioRxiv - Neuroscience 2024Quote: ... the captured genomic regions were cloned into the hSTARR-seq_ORI vector (Addgene #99296; (79)) following linearization of the vector through restriction enzyme digestion using AgeI-HF (NEB ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV5-hsyn-DIO-hM3D(Gq)-mCherry (Addgene, Catalog# v141469), pAAV5-hsyn-DIO-hM4D(GI)-mCherry (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV5-FLEX-tdTomato (Addgene, Catalog# 28306-PHP.S), pENN.AAV5.hSyn.TurboRFP.WPRE.RBG (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... a co-injection of AAV5- hsyn-FLEX-PSAM-GlyR-IRES-EGFP (AAV-FLEX-PSAM-GlyR-EGFP; Addgene, #119741) and AAV1-TRE-Cre (SignaGen Laboratories ...
-
bioRxiv - Neuroscience 2024Quote: ... Rats then received bilateral infusions of either AAV8-CAMKIIa-hM3D(Gq)-mCherry or AAV8-CaMKIIa-GFP (5×1012 vg/mL for both viruses; Addgene) into the VH (either A/P ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV expressing Cre-dependent GCaMP6s (100842-AAV9, AAV9.CAG.Flex.GCaMP6s, Addgene) was injected unilaterally above the arcuate nucleus (ARC ...
-
bioRxiv - Molecular Biology 2024Quote: The lentiviral TKOv3 sgRNA library (Addgene #90294) was used to perform pooled genome-wide CRISPR knockout screens ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2018] genomic DNA using RLO336/RLO338 and RLO337/RLO339 primers (Table 2) which introduce sequences homologous to the regions flanking the SacI and HindIII sites of pRG216 (Addgene #64528) [Gnügge and Rudolf 2017] ...
-
bioRxiv - Molecular Biology 2024Quote: ... The plasmid sequence is provided in the Supplemental Material and pSPObooster is available from Addgene (#216160).
-
bioRxiv - Molecular Biology 2024Quote: ... pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from Feng Zhang (Addgene plasmid # 62988 ...
-
bioRxiv - Neuroscience 2024Quote: ... For electrophysiological experiments 0.4 µL of AAV2-CaMKIIa-hChR2(H134R)-eYFP (Addgene #26969; Penn Vector Core, USA) was injected into either M1 or M2 ...
-
bioRxiv - Neuroscience 2024Quote: ... and 0.1 µL of AAV2-pCAG-FLEX-eGFP (Addgene #51502; titer: 7×10¹² vg/mL) was injected into the SNr during the same surgery ...
-
bioRxiv - Neuroscience 2024Quote: ... For transsynaptic labelling experiments 0.4 µL of AAV1-hSyn-Cre (Addgene #105553; Penn Vector Core, USA) was injected into either M1 or M2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5μg lentiviral guide expression vector pKLV2-U6gRNA5(BbsI)PGKpuro-2A-BFP-W (Addgene #67974) was linearised with 100 U of Bbs I-HF (NEB ...
-
bioRxiv - Neuroscience 2024Quote: ... or AAV9-FLEX-EGFP-WPRE (Addgene # 51502 ...
-
bioRxiv - Neuroscience 2024Quote: ... A total of 25 nl of AAV1-FLEX-tdTomato (Addgene # 28306 ...
-
bioRxiv - Neuroscience 2024Quote: ... envelope plasmid VSV-G (Addgene #12259) and transfer plasmids at a ratio of 9:4:14 ...
-
bioRxiv - Neuroscience 2024Quote: ... was injected with a mixture of Cre-expressing and Cre-dependent adeno-associated viral vectors carrying the genes for ChR2 and tdTomato (AAV9.CamKII.4.Cre.SV40 and AAV9.CAG.Flex.ChR2.tdTomato, Addgene). Following a post-injection survival period of 9 weeks ...
-
bioRxiv - Neuroscience 2024Quote: ... The coding regions of hOPTN (Addgene, #23053) and hOPTNΔC (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... pMitoTimer (Addgene, #52659), 4xmts-mScarlet-I (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... and meGFP-hTRAK1 (# 188664) were purchased from Addgene. The coding regions of hOPTN (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... his-hOPTN (Addgene, #23053), mOPTN (mouse tissue cDNA) ...
-
bioRxiv - Immunology 2024Quote: ... LentiCRISPR v2 (a gift from Feng Zhang (Addgene plasmid # 52961) (73) ...
-
bioRxiv - Molecular Biology 2024Quote: ... (for expression of HypaCas, Addgene #101178). Screening for knockout clones was performed via PCR and Sanger sequencing ...
-
bioRxiv - Molecular Biology 2024Quote: ... Two gRNAs targeting Exon 1 (targeting sequence GGGCGCGCTACCTGTCTCCG) and Exon 10 (targeting sequence GAACTGGACTTTGAAAGAGG) were cloned in BPK1520 (Addgene #65777) and transfected with Amaxa Nucleofector II together with BPK4410 ...
-
bioRxiv - Molecular Biology 2024Quote: ... pFA6a-NeonGreen-KanMX6 (Addgene plasmid 129099), and pSP1ctr5+-VN (Ioannoni et al ...
-
bioRxiv - Molecular Biology 2024Quote: ... with pCL-Eco (Addgene 12371) and 8 µg/ml final concentration of polybrene ...
-
bioRxiv - Molecular Biology 2024Quote: ... two sets of chemically synthesized DNA containing the target sequence (Table S6, Fig. S8) were subcloned between the EcoRI and BamHI sites in the pBluescript SK(+) vector (Addgene, Watertown, MA, USA) and designated “pBlue-SapiroTarget” and “pBlue-KazanTarget” ...
-
bioRxiv - Genomics 2024Quote: ... 0.2 μg of pMD2.G (Addgene 12259) were mixed in 500 µl Opti-MEM together with 2 μl PLUS reagent and incubated for 5 min at room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... generated by Gateway cloning of FP Entry plasmids into the pLEX_307 Destination construct (a gift from David Root, Addgene plasmid # 41392). From each FP transduction ...
-
bioRxiv - Molecular Biology 2024Quote: ... retroviral pMSCV-Flag/HA (Addgene, #41033) and pMSCV-3Flag (generated for this study ...
-
bioRxiv - Molecular Biology 2024Quote: ... pWZL-Blast RASGV12 (#12277, Addgene), and pWZL-neo HDM246 (a gift from Dr ...
-
bioRxiv - Genomics 2024Quote: ... the pIS-0 vector48 (RRID: Addgene_12178, Addgene, Cambridge, MA) was first linearized using SacI-HF and BmtI-HF restriction enzymes (New England Biolabs (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and pYPQ134B (Addgene # 179216) at the BsmBI site with Instant Sticky-end Ligase Master Mix (New England Biolabs®) ...
-
bioRxiv - Molecular Biology 2024Quote: ... the four paired of oligos were ligated into pYPQ131B (Addgene # 69281), pYPQ132B (Addgene # 69282) ...