-
No products found
because this supplier's products are not listed.
Goutam Dey, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... pLenti CMV Puro DEST (Addgene) for subsequent use.
-
No products found
because this supplier's products are not listed.
Christine E. Peters, et al.,
bioRxiv - Biophysics 2022
Quote:
... These SETD3 mutants were introduced into either EcoRV-digested pLenti-CMV-Puro-Dest (w118-1) or EcoRV-digested pLenti-CMVTRE3G-Puro-DEST (w811-1) by Gibson Assembly (New England Biolabs).
-
No products found
because this supplier's products are not listed.
Kristin Roseth Aass, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... The iRFP-ENTR4 was then recombinated into the pLenti-CMV-Puro-Dest by a LR (Invitrogen) gateway reaction as previously described 20 ...
-
No products found
because this supplier's products are not listed.
Kyung-Tae Lee, et al.,
bioRxiv - Cell Biology 2023
Quote:
... The pLKO.1-puro-CMV-tGFP vector (SHC003; Sigma Aldrich) was employed to generate ARRDC5 knockdown ...
-
No products found
because this supplier's products are not listed.
Mengxiao Ma, et al.,
bioRxiv - Cell Biology 2024
Quote:
... and 800 ng of the desired pLenti CMV Puro DEST or pLenti-TRE-rtta3G-BLAST construct using 7 μl of 1mg/ml polyethylenimine (PEI) (Polysciences). Approximately 48 hours post transfection ...
-
No products found
because this supplier's products are not listed.
Wenjian Han, et al.,
bioRxiv - Bioengineering 2021
Quote:
... with PCR and cloned into the pCDH-CMV-MCS-EF1-Puro vector (Promega). For the reporters containing disease-relevant mutations ...
-
No products found
because this supplier's products are not listed.
James H. McGinnis, et al.,
bioRxiv - Cancer Biology 2024
Quote:
We constitutively expressed EWSR1-FLI1 constructs using a CMV driven pLVX-IRES-puro (Clontech) backbone ...
-
No products found
because this supplier's products are not listed.
Shaon Basu, et al.,
bioRxiv - Biochemistry 2022
Quote:
... and subsequently cloned into pLenti-CMV-MCS-GFP-SV-puro using XbaI and BamHI to replace GFP or cloned directly into pLenti-CMV-MCS-GFP-SV-puro by Genscript using the same sites ...
-
No products found
because this supplier's products are not listed.
Florian Fäßler, et al.,
bioRxiv - Cell Biology 2022
Quote:
mRFP was amplified from aleu-mRFP (65) using GAGGACGTCGACATGGCCTCCTCCGAGGACGTCATCA/ GTCCTCACTAGTTTATGCTCCAGTACTGTGGCGGCCC and inserted into the second multiple cloning site of PSF- CMV-CMV-SBFI-UB-PURO (Merck, #OGS597-5UG) using SalI/SpeI restriction digest and ligation ...
-
No products found
because this supplier's products are not listed.
Kilian Roßmann, et al.,
bioRxiv - Physiology 2020
Quote:
... for TMR(d12) or 640 nm excitation and BP 670/30 (640-670/30 BD channel) for SiR(d12) ...
-
No products found
because this supplier's products are not listed.
Johannes F. Scheid, et al.,
bioRxiv - Immunology 2022
Quote:
... CMV and rotavirus were determined using IgG detection kits against the respective viruses: EBV and CMV (abcam), rotavirus (amsbio ...
-
No products found
because this supplier's products are not listed.
Shivansh Nigam, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and CD133-PE (Miltenyi Biotec, 130-113-670, 1:50) antibodies for 1hr on ice ...
-
No products found
because this supplier's products are not listed.
Frederic Lagarrigue, et al.,
bioRxiv - Cell Biology 2021
Quote:
... eFluor 670 was from Biolegend. PMA was from Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Elena Pires, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Gel filtration standard (1.35-670 kD, pI 4.5-6.9; BioRad) was used to ensure that the column was properly packed and the samples were evenly eluted ...
-
No products found
because this supplier's products are not listed.
Chris S. Mesnard, et al.,
bioRxiv - Neuroscience 2024
Quote:
... CMV-Cre mice obtained from Jackson Laboratories (B6.C-Tg(CMV-cre)1Cgn/J ...
-
No products found
because this supplier's products are not listed.
Ana Carreras Mascaro, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Puromycin (Puro, 0.5 - 8 µg/mL Invivogen, ant-pr-1), Doxycycline hyclate (Dox ...
-
No products found
because this supplier's products are not listed.
M. Kazim Panjwani, et al.,
bioRxiv - Immunology 2023
Quote:
... CMV infection/reactivation was determined by pp65 antigenemia assays prior to 2010 and by CMV qPCR (Roche Diagnostics) from 2010 onward.
-
No products found
because this supplier's products are not listed.
Samuel A. Kerk, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... water from the FluxPak hydration was exchanged for 200 μL/well of XF Calibrant 670 (Agilent) and the cartridge was returned to 37°C ...
-
No products found
because this supplier's products are not listed.
Yao-Tang Lin, et al.,
bioRxiv - Microbiology 2020
Quote:
... mouse anti-CMV pp28 monoclonal antibody (CH19, Santa Cruz Biotechnology), rabbit anti-ZAP polyclonal antibody (PA5-31650 ...
-
No products found
because this supplier's products are not listed.
Christine Chiasson-MacKenzie, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The shRNA constructs targeting mouse ezrin (5’-ATTTCCTTGTTATAATCTCCG-3’) in a pLKO-puro.1 vector from GE Healthcare and described in27 ...
-
No products found
because this supplier's products are not listed.
Kathrin Fuchs, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... The pLib_EF1A_nlstdTomato-2A-puro plasmid was generated by HiFi DNA assembly (Cell Signaling, E2621) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Jon Ondaro, et al.,
bioRxiv - Neuroscience 2024
Quote:
... PINK1 (1:1 000, BC100-494, Novus Bio) TOM20 (1:1 000, 11802-1-AP, Proteintech), GAPDH (1:50 000 ...
-
No products found
because this supplier's products are not listed.
Alessandro Angerilli, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Anti-rabbit 1:5000 (Jackson Immunoresearch 1:10000).
-
No products found
because this supplier's products are not listed.
Wei Zhang, et al.,
bioRxiv - Microbiology 2022
Quote:
... and Opal 670 Reagent (PerkinElmer) were used to stain the different channels at dilutions of 1:1500 in Multiplex TSA Buffer (ACDBio) ...
-
No products found
because this supplier's products are not listed.
Stefan Scholl, et al.,
bioRxiv - Plant Biology 2021
Quote:
... between 620-670 nm for mRFP and between 670-750 nm for FM4-64 using hybrid detectors (HyD; Leica Microsystems GmbH, Wetzlar, Germany). Images for non-quantitative purposes were adjusted in brightness and contrast using Fiji (Schindelin et al. ...
-
No products found
because this supplier's products are not listed.
Alexandra Blackman, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 200 mM NaCl and 100 µg/mL proteinase K (VWR 97062-670). After briefly centrifuging to spin down debris ...
-
No products found
because this supplier's products are not listed.
Max Lundberg, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... with a targeted insert size of 670 bp or with a Truseq DNA nano (Illumina, CA, USA) with a targeted insert size of 350 bp ...
-
No products found
because this supplier's products are not listed.
Rocher Caroline, et al.,
bioRxiv - Zoology 2020
Quote:
... pmaxGFP™ Vector (expressed under a CMV-promoter; LONZA) and a morpholino standard control oligo (Gene tools ...
-
No products found
because this supplier's products are not listed.
Khaled Ghandour, et al.,
bioRxiv - Neuroscience 2024
Quote:
... pLenti-TRE-hKiKGR plasmid was prepared using an EndoFree Plasmid Maxi kit (Qiagen). The lentivirus (LV ...
-
No products found
because this supplier's products are not listed.
Sarah D’Annunzio, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... CMV-Cre mice (JAX #006054) were purchased from Charles River Laboratories ...
-
No products found
because this supplier's products are not listed.
Muhammad M. Hasan, et al.,
bioRxiv - Microbiology 2023
Quote:
... Cultures were pulsed for 1 h with 50 μM O-propargyl-puromycin (OP-puro)(Tocris, catalog# 7391) prior to fixation at the indicated time points with 4% formaldehyde and permeabilizing with 0.25% triton X-100 ...
-
The original balance of enzymatic activities. Each lot assayed for collagenase, caseinase,...
Cat# LS004194,
100 mg, $42.00
Ask
Xin Shao, Lenora Volk,
bioRxiv - Neuroscience 2024
Quote:
Hippocampi were dissected from neonatal P0 homozygous KIBRA KO or PICK1 KO mice and incubated with 670 μg/mL Papain (Worthington #LS003119) and 100 μg/mL DNase (Sigma-Aldrich #DN-25 ...
-
No products found
because this supplier's products are not listed.
Matthew L. Goodwin, et al.,
bioRxiv - Immunology 2020
Quote:
... CMV glycoprotein–specific antibody binding was detected with phycoerythrin-conjugated goat anti-human IgG (2 μg/mL, Southern Biotech). Beads were washed and acquired on a Bio-Plex 200 instrument (Bio-Rad) ...
-
No products found
because this supplier's products are not listed.
Zachary J. Walker, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Protein translation was measured by flow cytometry by labeling nascent peptides using the puromycin analog O-propargyl-puromycin (OP-Puro) from the protein synthesis assay kit (Cayman Chemical) according to manufacturer instructions.
-
No products found
because this supplier's products are not listed.
Junjun Huang, Rong Jia, Jihua Guo,
bioRxiv - Cancer Biology 2024
Quote:
ChIP was performed in CAL 27 cells stably transfected by FLAG-tagged RUNX2 isoform II or vector (pLVX-IRES-puro) using ABclonal Sonication Chip Kit (ABclonal, Wuhan, China) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Srinjoy Sil, Jef D Boeke, Liam J Holt,
bioRxiv - Cell Biology 2022
Quote:
... 2 million quasi-stable HeLa M2 cells maintaining a pCEP-puro L1RP element were seeded in a 10-cm tissue culture dish (Corning, product number 430167) in complete puromycin media ...
-
No products found
because this supplier's products are not listed.
Ksenija Radic Shechter, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 50 pmol cardiolipin (14:1/14:1/14:1/15:1, Avanti Polar Lipids), and 50 pmol monolysocardiolipin (16:0/16:0/16:0 ...
-
No products found
because this supplier's products are not listed.
Shiyun Cao, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... HO-1 (1:1000, Bethyl), FBXO22 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Anamitra Ghosh, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Iba-1 (1:800, Wako or 1:500, Novus Biologicals), COX-2 (1:500 ...
-
No products found
because this supplier's products are not listed.
Lun Zhang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Iba-1 (Abcam, #ab178847, 1:100; GeneTex, #GTX101495, 1:50), GFAP (Cell Signaling Technology ...
-
No products found
because this supplier's products are not listed.
Lian E.M. Stadhouders, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... IGF-1 (100 ng ml-1; recombinant Human IGF-1, Peprotech, Cat#100-11 ...
-
No products found
because this supplier's products are not listed.
Rudi Mao, et al.,
bioRxiv - Cell Biology 2024
Quote:
... necrostatin-1 (Nec-1; Calbiochem, 480065), necrosulfonamide (NSA ...
-
No products found
because this supplier's products are not listed.
Ruilian Li, et al.,
bioRxiv - Microbiology 2021
Quote:
... After that, Samples were infiltrated in graded mixtures (1:3, 1:1, 3:1) of resin (EMS, Resin Mixture ...
-
No products found
because this supplier's products are not listed.
Matteo Napoli, et al.,
bioRxiv - Physiology 2024
Quote:
... rmICAM-1 (ICAM-1 Fc chimera; 15µg mL−1; R&D Systems), and rmCXCL1 (15µg mL−1 ...
-
No products found
because this supplier's products are not listed.
Arin B. Aurora, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 1 μM StemRegenin 1 (StemCell Technologies, Inc.), 10% charcoal stripped FBS (Thermo Fisher) ...
-
No products found
because this supplier's products are not listed.
Johannes Knabbe, et al.,
bioRxiv - Neuroscience 2020
Quote:
... α-Synaptophysin 1 (SyPhy1, 1:500; Synaptic Systems), α-Chromogranin A (Chr-A ...
-
No products found
because this supplier's products are not listed.
Fizzah A Choudry, et al.,
bioRxiv - Cell Biology 2020
Quote:
... A 1:1 Ampure XP (Beckman Coulter) PCR purification step was performed followed by assessment of size distribution using an Agilent high-sensitivity DNA chip (Agilent technologies ...
-
No products found
because this supplier's products are not listed.
Alexandra Thiran, et al.,
bioRxiv - Immunology 2023
Quote:
... UEA-1 Fluorescein (Vector laboratories; 1/1000) and WGA (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Rebecca E. Wagner, et al.,
bioRxiv - Cell Biology 2024
Quote:
... RFP (1:1000, Rockland 600-4-1-379), KI67 (1:400 ...
-
No products found
because this supplier's products are not listed.
Richard J Mills, et al.,
bioRxiv - Cell Biology 2021
Quote:
... After 1 h blocking using a 1:1 mix of LI-COR Odyssey Blocking Buffer (LI-COR Biotechnology) and PBS ...