Labshake search
Citations for Millipore Sigma :
1 - 50 of 10000+ citations for pLenti CMV TO Puro DEST 670 1 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... The pLKO.1-puro-CMV-tGFP vector (SHC003; Sigma Aldrich) was employed to generate ARRDC5 knockdown ...
-
bioRxiv - Molecular Biology 2024Quote: ... pLKO.1-puro-CMV-TurboGFP plasmid (Sigma-Aldrich, cat # SHC003) was used to generate stable cell lines expressing GFP ...
-
bioRxiv - Cancer Biology 2023Quote: ... Both HCC1954WT and HCC1954KO cells were transduced with the pLenti CMV Puro LUC reporter vector at MOI = 5 in the presence of 8 μg/mL of Polybrene (Sigma-Aldrich). Infected cells were selected by puromycin (2.5 μg/mL for 72h ...
-
bioRxiv - Cell Biology 2022Quote: ... a custom pLKO.1-puro-CMV- TurboGFP was purchased from Sigma-Aldrich, expressing a shRNA previously shown as efficiently targeting the CDS of PFN1 (5’- CCGGCGGTGGTTTGATCAACAAGAACTCGAGTTCTTGTTGATCAAACCACCGTTTTT-3’)79 ...
-
bioRxiv - Cancer Biology 2023Quote: Other plasmids used in the study were: pLKO.1-puro-CMV-TurboGFP (Sigma-Aldrich, SHC003), pLenti-C-mGFP-P2A-puro-FGF19 (Origene ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells growing at ∼70-80 % confluency were transfected with 1 μg of pLKO.1-puro-CMV-TurboGFP (Sigma Aldrich) or one of five mouse Tbx3 MISSION® shRNAs (TRCN0000348157 ...
-
bioRxiv - Genetics 2023Quote: ... TRC2-pLKO.5-puro-CMV-TurboGFP plasmid was used (SHC 203; Sigma-Aldrich). HEK293T cells were plated at 1 x105 cells per well of a 6 well plate and transfected with 1 µg of TRC2-pLK0.1 plasmid ...
-
bioRxiv - Neuroscience 2024Quote: Plasmid containing the TRIM21 shRNA target sequence GAGTTGGCTGAGAAGTTGGAA with a pLKO.1-hPGK-Puro-CMV-tGFP vector (Sigma, TRCN0000010839 ...
-
bioRxiv - Genomics 2022Quote: ... RRM1 (clone ID NM_001033.2-476s1c1) and CYP1B1 (clone ID NM_000104.2-1176s1c1) were obtained in pLKO.1-Puro-CMV-tGFP from Sigma Aldrich.
-
bioRxiv - Cancer Biology 2024Quote: ... Cytosolic expression of GFP or tdTomato was achieved by transduction with plKO.1-puro-CMV-TurboGFP (SHC003, Sigma- Aldrich, USA) or cytoplasmic tdTomato (LeGo-T2 ...
-
bioRxiv - Pathology 2024Quote: ... pH3 (06-670, Sigma-Aldrich); Ki67 (50-5698-82 ...
-
bioRxiv - Neuroscience 2022Quote: ... and thyroglobulin (Sigma-Aldrich, 670 kDa).
-
bioRxiv - Biophysics 2024Quote: ... and thyroglobulin (Sigma-Aldrich, 670 kDa). Before each measurement ...
-
bioRxiv - Biophysics 2023Quote: ... and thyroglobulin (Sigma-Aldrich, 670 kDa). Before each experiment 15 μL buffer was placed into a chamber formed by coverslip-Gasket and focus was searched and followed by locking it using autofocus function ...
-
bioRxiv - Molecular Biology 2024Quote: ... and thyroglobulin (Sigma-Aldrich, 670 kDa). Before each measurement ...
-
bioRxiv - Biochemistry 2024Quote: ... and thyroglobulin (Sigma-Aldrich, 670 kDa). Before each measurement ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLKO.1-puro-DDR1 (TRCN0000121163) and pLKO.1-puro-Sdc1 (TRCN0000302270) were ordered from Sigma. pCDH-CMV-MCS-EF1-puro-Col1α1-6*His and pLVX-IRES-Puro-NRF2E79Q-Flag were made by Sangon Biotech (Shanghai ...
-
bioRxiv - Cancer Biology 2021Quote: ... PDGCLs were lentivirally transduced with the MISSION® shRNA vector pLKO.1-puro-CMV-Turbo green fluorescent protein (TurboGFP)_shnon-target (#SHC016, Sigma, part of Merck, Darmstadt, Germany) for cytosolic TurboGFP expression ...
-
bioRxiv - Cancer Biology 2023Quote: pLKO.1-puro Mission vectors (Sigma Aldrich), containing short-hairpin RNA (shRNA) ...
-
bioRxiv - Microbiology 2024Quote: ... and thyroglobulin (Sigma-Aldrich Cat#T1001-100MG, 670 kDa). In brief ...
-
bioRxiv - Microbiology 2022Quote: ... pFlag-CMV (Sigma), pEGFP-C1 (Clontech ...
-
bioRxiv - Cancer Biology 2020Quote: ... pLKO.1-eGFP was generated from pLKO.1-puro (Sigma) by replacing the coding sequence of the puromycin resistance gene with that of eGFP using restriction sites BamHI and KpnI (5’-CGCGGATCCACCGGAGCTTACCATGGTGAGCAAGGGCGA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... pLKO.1-puro non-target shRNA (Sigma-Aldrich) was used to produce the shCTL clone.
-
bioRxiv - Neuroscience 2021Quote: ... The SHC001 pLKO.1-puro Empty Vector (Sigma) was used as control (shControl) ...
-
bioRxiv - Cancer Biology 2021Quote: ... An empty MISSION pLKO.1-puro (SIGMA Aldrich) was included as a control of the off-target effects ...
-
bioRxiv - Cancer Biology 2023Quote: ... and pLKO.1-puro empty vector (Sigma SHC001). For CRISPR interference (CRISPRi ...
-
bioRxiv - Neuroscience 2023Quote: ... and either shControl (pLKO.1-puro Sigma Aldrich) or shMSH3#59 (TRCN0000417959 Sigma Aldrich ...
-
bioRxiv - Immunology 2024Quote: ... and pLKO.1-Puro shRNA-FAM118B (TRCN0000130258, Sigma).
-
bioRxiv - Genetics 2021Quote: ... Then human 293T cells were transduced with lentiviral particles of plkoSCR (Mission plko.1 puro; SHC002) or shCNBP human (Mission plko.1 puro TRCN0000311158, SIGMA-ALDRICH) at a MOI=5 for 72h ...
-
bioRxiv - Cell Biology 2024Quote: ... pLKO.1-Neo-CMV-tGFP TIAM1 shRNA plasmid (Sigma Aldrich, Cat # 07202334MN ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLKO.1-puro carrying a sequence targeting EGFP (Sigma) was used ...
-
bioRxiv - Immunology 2021Quote: ... pLKO.1-puro eGFP shRNA control (Plasmid SHC005; Sigma) produced by packaging line HEK293FT ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human pLKO.1-puro-shRNAMAPK11 (Sigma SHCLNG-NM_002751; (TRCN0000199694), and pLKO.1-puro empty vector (Sigma SHC001) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Non-targeting shRNA plasmid pKLO.1-puro (Sigma, SHC202) and empty pKLO.1-hygro (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... Puromycin (puro, Sigma) treatment was performed 30 min before collecting the coverslips or as described in the text ...
-
bioRxiv - Neuroscience 2021Quote: ... we used pLKO.1-puro Mission shRNA vectors (Sigma-Aldrich). Target sequences are provided in Table S7 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The MISSION(R) pLKO.1-puro Empty Vector (SHC001, Sigma) was used as control (shCtl) ...
-
bioRxiv - Biochemistry 2023Quote: MISSION TRC1.5 pLKO.1-puro Non-Mammalian shRNA Control (Sigma) was used as a control shRNA.
-
bioRxiv - Cell Biology 2024Quote: ... containing the lentiviral vector pLKO.1-puro (SHC001, Sigma-Aldrich) were added dropwise on top of cells at a MOI (Multiplicity of infection ...
-
bioRxiv - Developmental Biology 2021Quote: p3x-FLAG-CMV-10 (Sigma) was used for the generation of PAX6 and PAX6(5A ...
-
bioRxiv - Cell Biology 2021Quote: ... pFLAG-CMV-6b (SIGMA-ALDRICH) was digested with HindIII ...
-
bioRxiv - Bioengineering 2023Quote: ... transfection with the pLKO.1-Neo-CMV-tGFP vector (Sigma-Aldrich, USA) was used to label cells with GFP.
-
bioRxiv - Immunology 2022Quote: ... Puromycin (PURO, Sigma, #P9620), Talabostat (VbP ...
-
bioRxiv - Immunology 2023Quote: ... Puromycin (PURO, Sigma, #P9620), M443 (MCE ...
-
bioRxiv - Microbiology 2023Quote: ... pPAX2 and pLKO.1-puro shRNAs expressing plasmids (MISSION, Sigma-Aldrich). Produced lentiviruses were concentrated and quantified as previously ...
-
bioRxiv - Cancer Biology 2023Quote: MISSION pLKO.1-puro-shRNAs-Vectors for Control (Sigma-Aldrich, #TRCN0000382379), LSD2 (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 µg of an shRNA vector (pLKO.1-puro vector-Sigma), 2 µg pMD2.g ...
-
bioRxiv - Immunology 2024Quote: ... pLKO.1-puro Non-Mammalian shRNA Control Plasmid DNA (SHC002, Sigma) and pLKO.1-Puro shRNA-FAM118B (TRCN0000130258 ...
-
bioRxiv - Cancer Biology 2024Quote: ... were purchased from Sigma-Aldrich and cloned into MISSION® pLKO.1-puro (Sigma-Aldrich, SHC001). The control pLKO.1-scrambled shRNA vector was purchased from Addgene (Plasmid 136035) ...
-
bioRxiv - Cancer Biology 2020Quote: ... to co-transfect pLKO.1-puro Non-Mammalian shRNA Control (Sigma#SCH002), pLKO.1-puro.shSLX4IP.1 ...