Labshake search
Citations for Agilent :
1 - 50 of 2677 citations for pLenti CMV TO Puro DEST 670 1 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... water from the FluxPak hydration was exchanged for 200 μL/well of XF Calibrant 670 (Agilent) and the cartridge was returned to 37°C ...
-
bioRxiv - Biochemistry 2022Quote: ... The Gal4 expression vector pFA-CMV (Agilent/Stratagene) was used as control and as cloning vector for the Gal4-L3MBTL3 fusions ...
-
bioRxiv - Biochemistry 2022Quote: ... The Gal4 expression vector pFA-CMV (Agilent/Stratagene) was used as control and as cloning vector for the Gal4-L3MBTL3 fusions ...
-
bioRxiv - Neuroscience 2023Quote: ... The transfer plasmid was constructed by replacing the CMV promoter of an AAV backbone plasmid (pAAV-CMV, Stratagene, San Diego, CA, USA) with a human Syn promoter ...
-
bioRxiv - Microbiology 2022Quote: ... Sections were stained with mouse anti human CMV (Dako, Agilent technologies ...
-
bioRxiv - Biophysics 2021Quote: ... The sample was placed on a cryostat (OptistatDN, Oxford) coupled to a FT-IR spectrometer (Cary 670, Agilent) equipped with a MCT detector and purged with dry nitrogen ...
-
bioRxiv - Immunology 2024Quote: ... PlatE cells were transfected with either the pMX-puro-mB3gnt5 or an empty pMX-puro vector using the transfection reagent Genejammer (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the CMV enhancer was amplified with the primers P322 and P323 using the phrGFPII-1 plasmid (Agilent Technologies, Santa Clara) as template ...
-
bioRxiv - Microbiology 2022Quote: ... Sections were stained with mouse anti human CMV (Dako, Agilent technologies, Glostrup, Denmark) primary antibody ...
-
bioRxiv - Bioengineering 2024Quote: ... AdV-CMV-DreAM-GFP was generated using the the AdEasy adenoviral system (Agilent) by Hanbio in Shanghai ...
-
bioRxiv - Plant Biology 2021Quote: ... and cloned into pVp16-Dest vector for IPTG (isopropyl-β-thiogalactopyranoside)-induced expression (3 h at 37°C) in E.coli strain ArcticExpress (Agilent). After sonication ...
-
bioRxiv - Biophysics 2023Quote: ... The transgenes were inserted into pShuttle-CMV of the AdEasy Adenoviral Vector System (Agilent #240009) which was used to produce recombinant adenovirus of the seven constructs ...
-
bioRxiv - Genetics 2021Quote: ... cloned into an expression plasmid driven by CMV promoter and modified using QuikChange Site-Directed Mutagenesis Kit (Agilent). For each affinity purification ...
-
bioRxiv - Biophysics 2021Quote: ... These myosin fragments were introduced downstream of the multi cloning site of the pShuttle-CMV vector (Agilent Technologies). For the double lever-arm length construct (double lever-arm length Myosin S1) ...
-
bioRxiv - Biophysics 2023Quote: ... These myosin fragments were introduced downstream of the multi cloning site of the pShuttle-CMV vector (Agilent Technologies). Recombinant myosin was expressed using an adenovirus/murine C2C12 myoblasts system ...
-
bioRxiv - Neuroscience 2023Quote: EEF1A2 mutations in both the CMV-NGFP-EEF1A2-Neo vector and the pcDNA3.1-CMV-Flag-EEF1A2 vector were generated using the QuikChange II site directed mutagenesis kit (Agilent) according to the manufacturers protocol using the following primers.
-
bioRxiv - Neuroscience 2023Quote: AAV plasmids carrying cDNA for hIL-6 downstream of a CMV promoter were co-transfected with pAAV-RC (Stratagene) encoding the AAV genes rep and cap ...
-
bioRxiv - Biochemistry 2023Quote: ... COS1 cells were transfected with pAdTrack-CMV expression plasmids (Table S1) using the GeneJammer transfection reagent (#204130, Agilent Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... Specific point mutations in Hmga1 3’UTRs (shown in Fig 3A) cloned into pRL-CMV vector were generated using site-directed mutagenesis kit (Stratagene). In addition ...
-
bioRxiv - Biochemistry 2022Quote: ... BioID2-tagged variants were generated by introducing a BamHI site between the 8xHis and MBP tags in the 8xHis-MBP-pFastBac1 modified with a CMV promoter vector by Quikchange Lightning site-directed mutagenesis (Agilent) and cloning BioID2 into the BamHI sites using In-Fusion EcoDry cloning according to manufacturer protocols.
-
bioRxiv - Neuroscience 2021Quote: ... was constructed by inserting the mKO1 gene (MBL Lifescience, Tokyo, Japan) and the WPRE sequence into an AAV backbone plasmid (pAAV-CMV; Stratagene).
-
bioRxiv - Neuroscience 2021Quote: ... pAAV-CMV-βglobin-intron-FLEX-MCS-WPRE was created by cloning a FLEX cassette with multicloning site into Cla1 and HindIII sites in pAAV-CMV-βglobin-intron-MCS-WPRE (Agilent). Sequence of the FLEX cassette was obtained from (Atasoy et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... The pAAV-FLEX-mCherry-WPRE construct was created by first cloning a FLEX cassette with MCS into Cla1 and HindIII sites in pAAV-CMV-MCS-WPRE (Agilent) to create pAAV-CMV-FLEX-MCS-WPRE ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfer plasmid was constructed by inserting cDNA fragment and WPRE sequence into an AAV backbone plasmid (pAAV-CMV, Stratagene, San Diego, USA). For production of an AAV-DJ vector (AAV-DJ-rSyn-GCaMP6s) ...
-
bioRxiv - Genetics 2024Quote: Recombinant adenoviruses expressing mouse SAR1A or SAR1B were constructed using pAdTrack-CMV and the AdEasy adenoviral vector system (Agilent Technologies, Lexington MA). Adenoviruses were amplified in Ad293 cells and purified using CsCl gradient ultracentrifugation ...
-
bioRxiv - Plant Biology 2024Quote: ... CMV genomic RNAs (strain Fny) were synthesized with 5’ monomethylated cap analog by T7 RNA Polymerase (Agilent Technologies, Santa Clara, CA, #600123) from PCR product templates (see Supplementary Table S1 for primer sequences) ...
-
bioRxiv - Microbiology 2022Quote: ... ORF6 mutations were introduced into the pLVX-StrepII-SARS-CoV-2-ORF6-IRES-Puro and pLVX-EF1α-SARS-CoV-2-ORF6-2xStrep-IRES-Puro plasmids using the QuickChange II-XL site-directed mutagenesis kit (Agilent) according to the manufacturer’s instructions using SDM primers listed below ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Cancer Biology 2020Quote: ... KpnI - HindIII fragment of Gemc1-MycDDK or Mcidas-MycDDK cDNA was then inserted into corresponding restriction sites in pShuttle-CMV vector (Agilent Technologies, Palo Alto, CA) to generate pShuttle-Gemc1 or pShuttle-Mcidas ...
-
bioRxiv - Bioengineering 2023Quote: ... The sequence of bPAC-cMyc-IRES-mCherry was carried in pShuttle-CMV vector for generation of adenovirus (AdbPAC) in 293AD cells with the AdEasy system (Agilent Technologies, Santa Clara, CA) (34) ...
-
bioRxiv - Neuroscience 2024Quote: ... was constructed by inserting the eNpHR3.0-EYFP fragment with a Woodchuck Hepatitis virus (WHV) posttranscriptional regulatory element (WPRE) sequence into an AAV backbone plasmid (pAAV-CMV, Stratagene, La Jolla, CA, USA).
-
bioRxiv - Neuroscience 2022Quote: ... 1 × 1 M (Agilent Technologies). Genomic DNA from wild-type mouse ES cells (CMTI-2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Sections were then incubated with primary antibodies for 48 h at 4°C (AXIN2 1:100, FZD1 1:100, LEF1 1:100, AQP1 1:100, OTX2 1:50, β-Catenin cell signaling 1:400, β-Catenin Dako 1:200), washed and subsequently incubated with secondary anti-mouse or anti-rabbit antibodies diluted in PBS (at 1:1000 ...
-
bioRxiv - Pathology 2023Quote: ... SMMS-1 (M3558, Dako, 1:100) and PG-M1 (M0876 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Ki-67 (DAKO MIB-1, 1:400), Iba1 (Waco 019-19741 ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-Iba-1 (1:500; Dako), rabbit anti-galanin (1:1000 ...
-
bioRxiv - Immunology 2022Quote: ... CD68 (Dako, PGM-1, 1:25 dilution) and CD163 (Leica Microsystems ...
-
bioRxiv - Immunology 2023Quote: ... and CD68 (1:400 PGM-1 DAKO). Antibody binding was visualized using secondary anti-mouse/anti-rabbit polymer HRP followed with TSA-Opal reagents (Akoya NEL811001KT) ...
-
bioRxiv - Bioengineering 2021Quote: ... Serotec) mouse monoclonal antibodies, or Aβ40 (1:200, Covance), Iba-1 (1:200, Wako) and GFAP (1:1000, DAKO) rabbit polyclonal antibodies ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-AIF-1/Iba1 (1:1000, 019741 DAKO); and secondary antibodies ...
-
bioRxiv - Pathology 2020Quote: ... and Ki-67 (1:100, MIB-1, Dako) in an Autostainer Link48 automated staining platform (Dako ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse anti-Ki67 (Dako, MIB-1, 1:100), mouse anti-DLX2 (Santa Cruz ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-tau (DAKO, AA002402-1, 1:500), mouse anti-total tau (Invitrogen ...
-
bioRxiv - Pathology 2024Quote: ... (1:5000 in 1% milk/TBST, Dako P0260) for 45 minutes ...
-
bioRxiv - Cancer Biology 2021Quote: ... before staining at a previously optimised dilution (BCL-xL 1:500; cleaved Caspase 3 1:500; MCL-1 1:200) and visualised with Liquid DAB (Agilent, UK). Ki67 (Agilent #M7240 ...
-
bioRxiv - Neuroscience 2020Quote: ... GFAP (1:200, rabbit, Dako; 1:1000, chicken, Millipore), MBP (1:500 ...
-
bioRxiv - Pathology 2020Quote: ... anti-HER2 (1:400 to 1:600, DAKO, Denmark), anti-PR antibody (DAKO ...
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies (NeuN, 1:20,000, Millipore, MAB377B; CD68, 1:1,000, Serotec, MCA1957S; GFAP, 1:10,000, Dako Z0334) were diluted in 0.3% Triton X in PBS and incubated for 12 hours at RT ...
-
bioRxiv - Cancer Biology 2020Quote: ... CD21 (DAKO, 1:25, CD23 (Leica, CD23-1B12, 1:50), CD4 (DAKO ...
-
bioRxiv - Cancer Biology 2021Quote: ... mouse anti-Ki67 (1:50, clone MIB-1, Dako, M7240), mouse anti-INSR (1:50 ...