-
No products found
because this supplier's products are not listed.
Rui Xiao, et al.,
bioRxiv - Physiology 2019
Quote:
... PCR probe for Cela1 (chymotrypsin-like elastase family, member 1) was purchased from ThermoFisher (Applied Biosystems ...
-
No products found
because this supplier's products are not listed.
Lei Liu, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... H2A histone family member X (H2AX)(cat#7631S, Cell Signaling Technology, Boston, MA), phospho-histone H2AX (cat#9718S ...
-
No products found
because this supplier's products are not listed.
Christina Pressl, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Solute Carrier Family 1 Member 3 (SLC1A3, Santa Cruz sc-515839 used at a concentration of 1:2000) ...
-
No products found
because this supplier's products are not listed.
Jessica Gartrell, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... using a rabbit anti-SLFN11 (anti-Schlafen family member 11) polyclonal antibody (Sigma-Aldrich Cat# HPA023030, RRID:AB_1856613) (1:25 dilution ...
-
No products found
because this supplier's products are not listed.
Danielle L Blackwell, et al.,
bioRxiv - Developmental Biology 2021
Quote:
DNA was extracted from all family members from whole blood using Puregene chemistry (Qiagen). Exome capture was undertaken in both affected individuals using the SureSelect 50 Mb All Exon Kit v3 (Agilent ...
-
No products found
because this supplier's products are not listed.
Jining Jia, et al.,
bioRxiv - Neuroscience 2020
Quote:
... solute carrier family 7 member 11 (SLC7A11) (rabbit, 55 kDa, ab175186, 1:5000, Abcam), Anti-5 Lipoxygenase (5-LOX ...
-
No products found
because this supplier's products are not listed.
Grant D. Jones, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Affinity-purified rabbit polyclonal antibodies specific to each eIF4E family member (Genscript) were used as the primary probe in western blotting ...
-
No products found
because this supplier's products are not listed.
Md. Alamgir Hossain, et al.,
bioRxiv - Immunology 2022
Quote:
... Biotinylation was performed using a BirA biotin-protein ligation kit (Avidity) on proteins produced with a C-terminal avidin tag sequence ...
-
No products found
because this supplier's products are not listed.
Jhon R. Enterina, et al.,
bioRxiv - Immunology 2021
Quote:
... and antibodies GL7-biotin (BioLegend), anti-mouse IgD (clone ...
-
No products found
because this supplier's products are not listed.
Emma Bergsten, et al.,
bioRxiv - Microbiology 2023
Quote:
... and a 1:500 dilution of an antibody against the phosphorylated form of H2A histone family member X (γH2Ax) (clone JBW301, Merck) and 1:200 phalloidin coupled to Alexa Fluor 568 ...
-
No products found
because this supplier's products are not listed.
Andrea Wetzel, et al.,
bioRxiv - Neuroscience 2023
Quote:
... TCF/LEF family antibody sampler kit (New England BioLabs), NFAT1 (New England BioLabs) ...
-
No products found
because this supplier's products are not listed.
Jordi Lambert, et al.,
bioRxiv - Cell Biology 2019
Quote:
... biotinylated protein was isolated by immunoprecipitation using anti-biotin (Jackson Immunoresearch), and levels of α5 integrin assessed by SDS-PAGE.
-
No products found
because this supplier's products are not listed.
Juan A. Perez-Bermejo, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Purified 53BP1 Tudor domain was labeled at exposed primary amine groups with NHS-biotin using ChromaLINK NHS-Biotin protein labeling kit (Vector Laboratories). 1 equivalent of chromalink biotin was incubated with the 53BP1 Tudor domain for 2 h and buffer exchanged into fresh PBS ...
-
No products found
because this supplier's products are not listed.
Niccolò E. Mencacci, et al.,
bioRxiv - Genetics 2020
Quote:
... A genome-wide analysis genotyping scan was performed in all six members of family A and in the proband of family B using the HumanCytoSNP-12 DNA Analysis BeadChip Kit (Illumina, San Diego), according to manufacturer’s instruction ...
-
No products found
because this supplier's products are not listed.
Nobuko Katoku-Kikyo, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Positive selection was subsequently applied with an antibody against biotin-conjugated integrin α7-biotin and anti-biotin MicroBeads (Miltenyi Biotec, 130-090-485), followed by MS columns (Miltenyi Biotec ...
-
No products found
because this supplier's products are not listed.
Oksana Iamshanova, et al.,
bioRxiv - Cell Biology 2022
Quote:
After extraction of proteins (see above) without proteinase and phosphatase inhibitors the Src activity was evaluated with ProFluor® Src-Family Kinase Assay (Promega).
-
No products found
because this supplier's products are not listed.
Lucia Bossoni, et al.,
bioRxiv - Biophysics 2021
Quote:
... with second antibody Rb-aMs/biotin (DAKO) for 1h at room temperature ...
-
No products found
because this supplier's products are not listed.
Abigael Cheruiyot, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Activity of the SMG1i against other PI3 kinase family members (PI3Kα, PI3Kβ, PI3Kγ, PI3Kδ, MTOR) was evaluated using Amplified Luminescent Proximity Homogeneous Assay (Alpha) Screen assays (Perkin Elmer and Echelon Biosciences). PI3K or mTOR protein (produced in Sf9 cells ...
-
No products found
because this supplier's products are not listed.
Lingling Zhang, et al.,
bioRxiv - Immunology 2023
Quote:
... Biotin Rabbit Anti-Mouse Caspase 3 (Clone C92-605; BD Biosciences ...
-
No products found
because this supplier's products are not listed.
Harsha Raheja, et al.,
bioRxiv - Microbiology 2023
Quote:
... Biotin-labelled HCV 3’UTR RNA was immobilized on streptavidin-coated sensor chips (GE Healthcare Lifescience) to a final concentration of 300 Resonance Units (RU)/flow cell ...
-
No products found
because this supplier's products are not listed.
Xiaolu Wei, et al.,
bioRxiv - Genomics 2021
Quote:
... rp49 5’-TAATACGACTCACTATAGGGCAGTAAACGCGGTTCTGCATG-3’ and 5’-CAGCATACAGGCCCAAGATC-3’) were transcribed using the Biotin RNA Labeling Mix (Roche) and T7 polymerase (Promega).
-
No products found
because this supplier's products are not listed.
Liping Zeng, et al.,
bioRxiv - Immunology 2022
Quote:
... The members were visualized on X-ray films or ChemiDoc Imaging System (BioRad, Hercules, CA) following the reaction with the enhanced chemiluminescence substrate (SuperSignal™ West Pico PLUS Chemiluminescent Substrate ...
-
No products found
because this supplier's products are not listed.
Rana Lebdy, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Antibodies against the following proteins were used: Biotin (Bethyl A150-109 and Jackson Immunoresearch 200-002-211) ...
-
No products found
because this supplier's products are not listed.
Maude Strobino, et al.,
bioRxiv - Genetics 2019
Quote:
... EdU was coupled to a cleavable biotin-azide linker (Azide-PEG(3+3)-S-S-biotin) (Jena Biosciences, Cat. No. CLK-A2112-10) using the reagents of the Click-it Kit (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Fernando Y. Maeda, et al.,
bioRxiv - Cell Biology 2021
Quote:
... liposomes were generated from 5 mM 1,2-dioleoyl-sn-glycero-3-phosphocholine plus 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-cap-biotin (Avanti Polar Lipids) at a 100:1 molar ratio by sonication ...
-
No products found
because this supplier's products are not listed.
Raquel Martinez-Curiel, et al.,
bioRxiv - Neuroscience 2023
Quote:
... member 3A (Wnt3A) (10 ng/mL, R&D Systems) and cyclopamine (1 μM ...
-
No products found
because this supplier's products are not listed.
Thomas Blackwell, et al.,
bioRxiv - Biophysics 2020
Quote:
... Biotin-labeled actin (2 µM) was prepared using 10% biotin actin (Cytoskeleton) in KMg25 buffer ...
-
No products found
because this supplier's products are not listed.
Philipp Kolb, et al.,
bioRxiv - Microbiology 2020
Quote:
... Pre-incubation with Protein G (Rockland, Biotin conjugated) was performed prior to incubation with FcγR ectodomains (diluted 1:100) ...
-
No products found
because this supplier's products are not listed.
Li Zhong, et al.,
bioRxiv - Cell Biology 2021
Quote:
... ATP binding cassette subfamily A member 1 (Abca1; 1:500, Ag24118; Proteintech), Patched (Ptch ...
-
No products found
because this supplier's products are not listed.
Lingya Yao, et al.,
bioRxiv - Plant Biology 2022
Quote:
... The α-GFP antibody (Abmart) was used to detect the NPR1-YFP protein and α-Histone 3 antibody (Agrisera) was used to detect Histone 3 (as loading control) ...
-
No products found
because this supplier's products are not listed.
Takehiro Takahashi, et al.,
bioRxiv - Neuroscience 2021
Quote:
The 5’UTR promoter region of mouse L1Spa belonging to LINE-1 Tf family was amplified with the primers (Fw; AATGGGCAGAGCTCGTTTAG, Rv: CTGGTAATCTCTGGAGTTAG) and Takara LA Taq polymerase with GC buffer (Takara Bio) using pTN201 plasmid (a kind gift from Dr ...
-
No products found
because this supplier's products are not listed.
Mary Kay Thompson, et al.,
bioRxiv - Biochemistry 2022
Quote:
... MTSEA biotin-XX (MTS-biotin, Biotium #90066) was added to a final concentration of 0.04 mg/ml as suggested35 ...
-
No products found
because this supplier's products are not listed.
Uddalak Majumdar, et al.,
bioRxiv - Cell Biology 2020
Quote:
... biotin switch technique was performed using S-Nitrosylated Protein Detection Kit (Cayman Chemical# 10006518). Immunofluorescence staining was performed following the manufacturer’s protocol and images were captured using Olympus IX51 microscope attached with Olympus DP72 camera ...
-
No products found
because this supplier's products are not listed.
Yousef M. Alhammad, et al.,
bioRxiv - Microbiology 2023
Quote:
... Primary antibody incubation was conducted for 3 hours at room temperature (1:2,000 α-N protein, Sino Biological 40143-R001 ...
-
No products found
because this supplier's products are not listed.
Natasha M. Bourgeois, et al.,
bioRxiv - Systems Biology 2023
Quote:
... Antibodies against DENV non-structural protein 3 (NS3) were obtained from GeneTex (GTX124252), conjugated to Alexa Fluor 647 (NS3-647) ...
-
No products found
because this supplier's products are not listed.
Hana Antonicka, et al.,
bioRxiv - Cell Biology 2020
Quote:
mCherry-ER fusion protein was amplified by PCR from mCherry-ER-3 plasmid (Addgene) and cloned into Gateway modified pBABE (in house) ...
-
No products found
because this supplier's products are not listed.
Mark R. MacRae, et al.,
bioRxiv - Biophysics 2022
Quote:
... the purified and concentrated protein was incubated with 1:3 protein to biotin ratio of 1mM NHS-PEG4-Biotin (VWR #PI21362) for 1 hr at room temperature ...
-
No products found
because this supplier's products are not listed.
Jean-Philippe Guégan, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... The level of protein binding to DNA consensus sequence was then assessed by ELISA using the TransAM NF-kB Family kit (Active Motif) according to manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Gali Maor, Ronald R. Dubreuil, Mel B. Feany,
bioRxiv - Neuroscience 2023
Quote:
... biotin-conjugated secondary antibodies (1:200, SouthernBiotech) and avidin-biotin-peroxidase complex (Vectastain Elite ...
-
No products found
because this supplier's products are not listed.
Helen O. Masson, et al.,
bioRxiv - Systems Biology 2023
Quote:
... Proximal protein biotinylation occurs with treatment of H2O2 and tyramide-biotin (TSA Biotin System, Akoya Bioscience NEL700A001KT), resulting in tyramide-biotin radicalization and covalent deposition onto proximal proteins ...
-
No products found
because this supplier's products are not listed.
Idil Ulengin-Talkish, et al.,
bioRxiv - Biochemistry 2021
Quote:
... biotin incorporation was detected using fluorophore conjugated Streptavidin antibody (Licor IRDye 800CW Steptavidin, LI-COR Biosciences). Amount of ABHD17A and APT2 was probed using FLAG (1:2,500 ...
-
No products found
because this supplier's products are not listed.
Araceli Perez-Lopez, et al.,
bioRxiv - Immunology 2022
Quote:
... human anti-myeloperoxidase (MPO)-Biotin antibody (clone MPO421-8B2, Novus Biologicals), and APC/Cy7 streptavidin (BioLegend) ...
-
No products found
because this supplier's products are not listed.
Eric W. Fowler, et al.,
bioRxiv - Bioengineering 2021
Quote:
Expression of TGF-β family members was investigated using a Human TGF beta Array C2 (AAH-TGFB-2-2; RayBiotech®, Peachtree Corners, GA). Medium collected from hydrogel cell constructs from days 3-6 was pooled from three biological replicates and used to carry out the assay following the manufacturer’s procedure ...
-
No products found
because this supplier's products are not listed.
Philippe F.Y. Vincent, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the Basic Helix-Loop-Helix Family Member BHLHB5 Cre mice (Bhlhb5Cre/+29,30) crossed with homozygous floxed Ai9 mice (Ai9fl/fl; Td-Tomato, Jackson Laboratory #007905) and 3 ...
-
No products found
because this supplier's products are not listed.
Omar El Bounkari, et al.,
bioRxiv - Immunology 2021
Quote:
... The non-selective MIF family cytokine inhibitor 4-IPP was obtained from Tocris Bioscience.
-
No products found
because this supplier's products are not listed.
Tetsuro Yamamoto, et al.,
bioRxiv - Immunology 2023
Quote:
Biotin-labeled (BT) monkey IgA antibody (Mabtech, Sweden), BT monkey IgA(alpha-chain ...
-
No products found
because this supplier's products are not listed.
Edward W. Roberts, et al.,
bioRxiv - Immunology 2019
Quote:
... antibody and negative selection was performed by using an EasySep Biotin Selection Kit (Stemcell Technologies) following manufacturers instructions ...
-
No products found
because this supplier's products are not listed.
Darko Bosnakovski, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Antibody-bound chromatin was then coupled to protein A beads (Diagenode, C03020002) for three hours at 4° C ...
-
No products found
because this supplier's products are not listed.
Yuanhui Ma, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 3) 8 ul of 5mM Biotin-Alkyne (C21H35N3O6S, Click Chemistry Tools), and 4 ...
-
No products found
because this supplier's products are not listed.
Hanbin Bao, et al.,
bioRxiv - Plant Biology 2024
Quote:
... the eYFP fluorescence of fusion proteins was assayed 2–3 days after infiltration using a confocal microscope (Leica TCS SP8). For the Split–LUC assay ...