-
No products found
because this supplier's products are not listed.
Nicola Schmidt, et al.,
bioRxiv - Genomics 2023
Quote:
... accession number OY726583) marking an intercalary satDNA family (Kubis et al., 1998) was directly labeled with DY415-dUTP (Dyomics). The probe ‘pTS4.1’ for the pericentromeric satDNA in Patellifolia species (Schmidt et al. ...
-
No products found
because this supplier's products are not listed.
Anne-Sophie Hafner, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Biotin was detected with a rabbit anti-biotin antibody coupled to 1 nm nanogold particles (1:100, FluoroNanogold Alexa-594, Nanoprobes). Samples were post-fixed in 1% glutaraldehyde in 0.2 mM HEPES pH = 7.2 for 30 min and fixation was quenched with 100 mM Glycine in PBS for 10 min ...
-
No products found
because this supplier's products are not listed.
Matthew J. Shannon, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... binned trophoblast-subtype (i.e., CTB, TSC, cCTB, EVT, or SCTp) production and reception of selected gene family signals (ADAM, BMP, EGF ...
-
No products found
because this supplier's products are not listed.
Amadeus Xu, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Glass coverslips were functionalized with a layer of biotin and biotin-PEG (Rapp Polymere), while glass slides were passivated with PLL-PEG (SuSoS ...
-
No products found
because this supplier's products are not listed.
Chandra S. Bathula, et al.,
bioRxiv - Biochemistry 2021
Quote:
RNA-ARE probes were designed from the Fgf21-3’UTR ARE sequence and synthesized with 5’-biotin end-labelling (IDT DNA technologies). HEK293 cells were transfected with the ZFP36L1 expression plasmid (pcDNA 3.1+/C-(K)-DYK Zfp36l1 ...
-
No products found
Adam D. Cawte, Peter J. Unrau, David S. Rueda,
bioRxiv - Cell Biology 2019
Quote:
... The modified Thiazole Orange dye (TO1-3PEG-Biotin) was synthesized by Applied Biological Materials Inc ...
-
No products found
because this supplier's products are not listed.
Hamza A. A. Elati, et al.,
bioRxiv - Microbiology 2023
Quote:
... 2’,3’-dideoxyuridine was from Carbosynth; Pyrimethamine was from Fluka ...
-
No products found
because this supplier's products are not listed.
Matthew R. King, Sabine Petry,
bioRxiv - Biochemistry 2019
Quote:
80µL of a dilute solution of GMPCPP-stabilized microtubules containing 10% Alexa568-labled tubulin and 10% biotinylated-tubulin were attached via anti-biotin antibodies adhered to the surface of a blocked (κ-casein) coverslip-bottomed CultureWell (Grace BioLabs: 112359). The microscope stage was positioned and focused on MTs ...
-
No products found
because this supplier's products are not listed.
Célia Caillet-Saguy, Nicolas Wolff,
bioRxiv - Biochemistry 2021
Quote:
The biotinylated peptide (sequence Biotin-(PEG3)-GFQNTDDVQTSF)(Figure 1C) was synthesized in solid phase using Fmoc strategy (Proteogenix). The sequence encompasses a biotinyl group ...
-
No products found
because this supplier's products are not listed.
Md. Golam Kibria, et al.,
bioRxiv - Biophysics 2022
Quote:
... 200 μL of protein samples in a 3-mm optical path length quartz cuvette (T-507, TOSOH, Japan) was used for the measurements ...
-
No products found
because this supplier's products are not listed.
Fei Jin, et al.,
bioRxiv - Biophysics 2020
Quote:
... Antibody-bound proteins were visualized using Western blot detection reagents (Immunostar LD, Wako Laboratory Chemicals). Images were captured with an LAS-3000 Mini imaging system (Fujifilm).
-
No products found
because this supplier's products are not listed.
Maëliss Champagne, et al.,
bioRxiv - Microbiology 2023
Quote:
... 0.1 µg/mL of goat anti-bat biotin-labeled IgG (Euromedex, Souffelweyersheim, France) was added to each well and incubated for 30 min at 300 rpm at room temperature ...
-
No products found
because this supplier's products are not listed.
Linlin You, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... coli TTC-pause at 13 mg/mL was incubated with 3-([3-cholamidopropyl] dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, 8 mM, final concentration; Hampton Research Inc.) prior to grid preparation ...
-
No products found
because this supplier's products are not listed.
Pallavi Jain, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... protein was extracted in RIPA lysis buffer (Norgen Biotek Corp.) supplemented with protease and phosphatase inhibitor cocktail (Thermofisher Scientific ...
-
No products found
because this supplier's products are not listed.
Gowri Nayak, et al.,
bioRxiv - Physiology 2019
Quote:
... body temperature was measured rectally with a RET-3 Microprobe Thermometer (Kent Scientific) every 20 minutes for the duration of the assay ...
-
No products found
because this supplier's products are not listed.
Joshua F.E. Koenig, et al.,
bioRxiv - Immunology 2023
Quote:
... the plate was coated with anti-IgE (LO-ME-3, Fitzgerald, 10R-I105A), and detection was performed using anti-IgE (23G3 ...
-
No products found
because this supplier's products are not listed.
Ellen Van Gulck, et al.,
bioRxiv - Cell Biology 2023
Quote:
The Tat66 (T66) protein was synthesized as trifluoroacetate salt by Bachem. The provided lyophilized powder was resuspended in sterile water containing 1mM DTT to a final concentration of 1 mg protein/mL ...
-
No products found
because this supplier's products are not listed.
Eillen Tecle, et al.,
bioRxiv - Immunology 2021
Quote:
RNA was extracted using TRI reagent and 1-Bromo-3-chloropropane (Molecular Research Center, Inc.), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Chao Gao, et al.,
bioRxiv - Biochemistry 2020
Quote:
... for 3 min and separated on a C18 analytical column (picofrit 75 μm ID x 150 mm, 3 μm, New Objective) using a linear gradient of 2 % to 45 % solvent B (80% acetonitrile ...
-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A Mouse Relaxin-3 ELISA Kit was purchased from Signalway Antibody LLC (MD ...
-
This product is a 25.7 kDa Human SHISA3 membrane protein expressed in HEK293T. The protein is...
Cat# MP0284J,
1.0 case, Inquiry
Ask
Mohammad Barghouth, et al.,
bioRxiv - Physiology 2022
Quote:
Anti-insulin VHH Single Domain Antibody tagged with biotin was purchased from Creative Biolabs (Cat# NAB-1554-VHH); guinea pig primary IgG anti-insulin antibody from EuroDiagnostica (B65-1) ...
-
No products found
because this supplier's products are not listed.
Ana Joaquina Jimenez, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Cryosections were incubated with a rabbit polyclonal anti-Biotin antibody (Rockland/Tebu-Bio) followed by protein A-10nm gold conjugate (CMC ...
-
No products found
because this supplier's products are not listed.
Lu Lv, et al.,
bioRxiv - Biochemistry 2020
Quote:
... D-Biotin (Targetmol, T1116) was added to the transfected cells at a final concentration of 50 μM ...
-
No products found
because this supplier's products are not listed.
Yaozong Chen, et al.,
bioRxiv - Microbiology 2021
Quote:
... and incubated with goat anti-guinea pig C3 antibody conjugated with biotin (Immunology Consultants Laboratory) at RT for 1 h followed by incubation with streptavidin R-Phycoerythrin (PE ...
-
No products found
because this supplier's products are not listed.
NV DiBenedetto, et al.,
bioRxiv - Microbiology 2023
Quote:
... diluted at 4ng/ml in PBS was used for the capture antibodies and the T4G1 monoclonal antibodies previously coupled to biotin were used as detection antibodies (BBI solution, 1:10000 dilution) with streptavidin HRP (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Christopher M. Yellman,
bioRxiv - Genetics 2021
Quote:
... The native Nop1 protein was stained with the MCA-28F2 mouse monoclonal antibody (EnCor Biotechnology), followed by anti-mouse CY3 (Jackson ImmunoResearch)
-
No products found
because this supplier's products are not listed.
Rory N. Pruitt, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Protein blotting was performed using antibodies against GFP (Torrey Pines Biolabs, Secaucus, New Jersey, US), HA (Sigma ...
-
No products found
because this supplier's products are not listed.
Simon N. Chu, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 3% antibody serum (heat-inactivated; Atlanta Biologicals, Flowery Branch, GA, USA), 2% human plasma (from umbilical cord blood) ...
-
No products found
because this supplier's products are not listed.
Bridget A. Luckie, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... MI) and CGXII media (without biotin or protocatechuic acid) was purchased from Teknova (Hollister, CA). Miller Luria broth (LB ...
-
No products found
because this supplier's products are not listed.
Qiao Wang, et al.,
bioRxiv - Pathology 2022
Quote:
... Precipitated proteins were detected with an anti-GFP antibody (#A02020; Abbkine), an anti-mCherry antibody (#A02080 ...
-
No products found
because this supplier's products are not listed.
Xiaoyun Ji, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... caspase-3 activity in cell lysates was measured using a Caspase-3 Fluorescence Assay Kit (Biomol Research Laboratories ...
-
No products found
because this supplier's products are not listed.
Francis Ledesma, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Hydrogen Peroxide (3% w/w) was purchased from Thomas Scientific. Sodium hypochlorite was purchased from Thomas Scientific ...
-
No products found
because this supplier's products are not listed.
Eva M. Struijf, et al.,
bioRxiv - Immunology 2023
Quote:
... Complement protein C4 was obtained from Complement Technology. Complement proteins C5 WT (unless stated differently ...
-
No products found
because this supplier's products are not listed.
Renée M. van der Sluis, et al.,
bioRxiv - Immunology 2021
Quote:
... were added to Calu-3 cells in 50 μL PBS and antibodies neutralizing IFNα (mouse anti-human IFN alpha antibody, clone MMHA-2, PBL Assay Science Cat#21100-2) or isotype control (Purified mouse IgG1 ...
-
No products found
because this supplier's products are not listed.
Zsolt G. Venkei, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... the 50-90 nt (14-54 nt small RNA+ 36 nt 3′ UMI adapter) 3′ ligated product was purified from a 15% denaturing urea-polyacrylamide gel (National Diagnostics). After overnight elution in 0.4 M NaCl followed by ethanol precipitation ...
-
No products found
because this supplier's products are not listed.
Coralie Berthoux, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Recombinant human BDNF protein was purchased from Hello Bio. Salts for making ACSF and internal solutions were purchased from Sigma-Aldrich.
-
No products found
because this supplier's products are not listed.
Lien D. Nguyen, et al.,
bioRxiv - Neuroscience 2022
Quote:
Total protein was extracted using RIPA buffer (Boston Bioproducts) supplemented with Complete ...
-
No products found
because this supplier's products are not listed.
Marta Casal Moura, et al.,
bioRxiv - Immunology 2022
Quote:
... and the moAb WGM2 (targeting Epitope 3) was purchased from Hycult Biotech Inc ...
-
No products found
because this supplier's products are not listed.
Teodors Pantelejevs, Marko Hyvönen,
bioRxiv - Biochemistry 2022
Quote:
... lysate was loaded on a 3 mL Ni-NTA agarose matrix (Cube Biotech), after which column matrix was washed with 10 CV Nickel Buffer A ...
-
No products found
because this supplier's products are not listed.
Nada Verdel, et al.,
bioRxiv - Bioengineering 2020
Quote:
... The contents was homogenized 5 minutes at maximum vortex speed (IKA genius 3), serially diluted to 10−10 in 9 g/L NaCl ...
-
No products found
because this supplier's products are not listed.
Christine E. Nelson, et al.,
bioRxiv - Immunology 2022
Quote:
... at a 1:10000 dilution and Goat anti-monkey IgA-Biotin (Alpha Diagnostic International #70049) at a 1:5,000 dilution in Dilution Buffer was added ...
-
LC Laboratories' Product Number R-8200 - Ribociclib, Free Base (Lee011, CAS 1211441-98-3), >99%...
Cat# R-8200, SKU# R-8200_100mg,
100 mg, $127.00
Ask
Rohan N. Shah, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 3 µM CHIR99021 (LC Laboratories), 1 µM PD0325901 (LC Laboratories) ...
-
No products found
because this supplier's products are not listed.
Chiu-An Lo, Brian Chen,
bioRxiv - Cell Biology 2019
Quote:
The optimal sgRNA in pCFD3: U6:3-gRNA vector was microinjected into embryos (BestGene, Inc) to create a transgenic fly constitutively expressing the Rpl13a-specific sgRNA ...
-
No products found
because this supplier's products are not listed.
Antara Das, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Each mouse was briefly anesthetized using isoflurane and a rectal temperature probe (RET 3, Braintree Scientific) was stably inserted and secured to the tail ...
-
No products found
because this supplier's products are not listed.
Itamar Harel, et al.,
bioRxiv - Neuroscience 2022
Quote:
... equipped with 3 emCCDs (Evolve, Photometrics Inc.) using an Olympus UPlanApo 100x (NA 1.40 ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Argentinian AntiCovid Consortium, et al.,
bioRxiv - Biochemistry 2020
Quote:
... This culture was used to inoculate 3 L of LSM with 40 g L-1 glycerol (supplemented with 3.5 mL L-1 PTM1 and 3.5 ml L-1 biotin 0.02% w/v) in a 7-L BioFlo 115 bioreactor (New Brunswick Scientific; Edison, NJ), which was interfaced with Biocommand Bioprocessing software (New Brunswick Scientific ...
-
No products found
because this supplier's products are not listed.
Jonathan D Teo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Six distinct fields of view per mouse were imaged at 15,000x magnification and captured as 3×3 tile scans using the JEOL integrated software and a high-sensitivity sCMOS camera (JEOL Matataki Flash). G-ratios were calculated as the diameter of the axon lumen divided by the diameter of the lumen plus myelin sheath (Song et al. ...
-
No products found
because this supplier's products are not listed.
Lauren Kane, et al.,
bioRxiv - Genetics 2021
Quote:
... and Chroma #89014ET (3 colour) or #89000ET (4 colour) single excitation and emission filters (Chroma Technology Corp., Rockingham, VT) with the excitation and emission filters installed in Prior motorised filter wheels ...
-
No products found
because this supplier's products are not listed.
Bryan D. Ryder, et al.,
bioRxiv - Biochemistry 2020
Quote:
... the protein solution was loaded into 3.5kDa cutoff Biotech CE Dialysis Tubing (Spectrum Labs) and dialyzed overnight at 4°C in 1xPBS to restore native folding ...