-
No products found
because this supplier's products are not listed.
Otto Kauko, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Antibodies to Tcf4 (Clone 6H5-3 Exalpha Biologicals), β-catenin (Rabbit Polyclonal Antibody ...
-
No products found
because this supplier's products are not listed.
Xi Chen, et al.,
bioRxiv - Bioengineering 2021
Quote:
... hFIX protein was detected by a goat-anti-hFIX antibody (1:2000; Affinity Biologicals, GAFIX-AP). Mouse-anti-β-actin antibody (1:5000 ...
-
No products found
because this supplier's products are not listed.
Takanori Eguchi, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... Overexpressed proteins in the chromatin fraction was analyzed by western blotting using anti-MZF1 antibody (Assay Biotechnology) and anti-SCAND1 antibody (ab64828 ...
-
No products found
because this supplier's products are not listed.
Rui Yan, Kun Chen, Ke Xu,
bioRxiv - Cell Biology 2021
Quote:
... 80 μM D-biotin (J&K Scientific 322564) was added to the imaging medium to release the cargo ...
-
No products found
because this supplier's products are not listed.
Leila Feiz, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Immunodetection of the maize DELLA proteins was performed using anti-SLR1 primary antibody (Cosmo Bio USA, Carlsbad, California) (2:10,000 ...
-
No products found
because this supplier's products are not listed.
Jugal Mohapatra, et al.,
bioRxiv - Biochemistry 2021
Quote:
... was activated with PyAOP (3 eq, Oakwood Chemical) and N,N-diisopropylethylamine (DIPEA ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Navid Farhoudi, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 19.1 mg of 3-aminophenylboronic acid (3-APB, Frontier Scientific) was dissolved in 87 µL of dimethyl sulfoxide (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Paresh P Kulkarni, et al.,
bioRxiv - Cell Biology 2023
Quote:
Protein C activity in WT and Apoh-/- plasma was performed using the Chromogenix Coamatic Protein C activity kit (Diapharma). Briefly ...
-
No products found
because this supplier's products are not listed.
Yanan Lyu, et al.,
bioRxiv - Neuroscience 2022
Quote:
3-morpholinosydnonimine(SIN-1) was purchased from Focus Biomolecules(Plymouth Meeting, PA USA). It could spontaneously release nitric oxide(NO ...
-
No products found
because this supplier's products are not listed.
Eva Jarc Jovičić, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 500 nM BHT and IS (8 pmol 18:3/18:3/18:3 triacylglycerol, 14:0/14:0 phosphatidylcholine, Larodan, Solna ...
-
No products found
because this supplier's products are not listed.
José Ursic-Bedoya, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and protein quantification was assayed using human FGF19 ELISA kit (Biovendor, RD191107200R). Protein was then diluted 1:2 in PBS+0.2%BSA and stored at - 20°C.
-
No products found
because this supplier's products are not listed.
Eric L. Van Nostrand, et al.,
bioRxiv - Genomics 2020
Quote:
... 3% Trichloroacetic acid (Glen Research) as the deblocking solution ...
-
No products found
because this supplier's products are not listed.
Mirjana Grujic, et al.,
bioRxiv - Immunology 2022
Quote:
... and 3 µl Draq7 (Biostatus, Shepshed Leicestershire ...
-
No products found
because this supplier's products are not listed.
Tomás Urzúa Lehuedé, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 3% Gelzan (PhytoTechnology laboratories, USA) plates and stored at 4°C for 3 days in the dark ...
-
No products found
because this supplier's products are not listed.
Alberto Domingo López-Muñoz, et al.,
bioRxiv - Microbiology 2021
Quote:
... alone or in combination with purified recombinant proteins were placed in the lower chamber of a 96-well ChemoTx System plate (Neuro Probe # 101-3 and # 101-5) in RPMI 1640 1% FBS ...
-
No products found
because this supplier's products are not listed.
Annu Nummi, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Secondary antibody was an HRP-polymer anti-rabbit antibody (BiositeHisto Nordic Biosite cat. no KDB-Z47C3W). Immunoreactivity of antibodies was controlled in sections of porcine kidney ...
-
No products found
because this supplier's products are not listed.
Amanda P. Waller, et al.,
bioRxiv - Pathology 2020
Quote:
... ELISA and immunoblot antibodies were validated using species-specific positive (purified species-specific protein; Haematologic Technologies, Inc, Essex Juntion, VT) and non-specific protein negative controls ...
-
No products found
because this supplier's products are not listed.
Nguyen-Vi Mohamed, et al.,
bioRxiv - Neuroscience 2021
Quote:
... hMOs were incubated in a shaker (100 rpm, 37°C) for 3 days with primary antibodies: rabbit anti-tyrosine hydroxylase (TH, 1:500, Pel-Freez Biologicals, AR, USA) and chicken anti-microtubule associated protein 2 (MAP2 ...
-
No products found
because this supplier's products are not listed.
Robert V. Blair, et al.,
bioRxiv - Pathology 2020
Quote:
Serum samples collected at preinfection and at necropsy were tested for binding IgG antibodies against SARS-CoV-2 S1/S2 proteins using an ELISA kit from XpressBio (cat# SP864C). The assays were performed per directions of the manufacturer ...
-
No products found
because this supplier's products are not listed.
James Peak, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and Fluorogold (FG; 3% in saline; Fluorochrome) into the GPe and SNr ...
-
No products found
because this supplier's products are not listed.
Seonhwa Lee, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Antibody stabilizer solution was purchased from Boca Scientific (Dedham, MA, USA).
-
No products found
because this supplier's products are not listed.
Carla Merino, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
4-(Methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) was obtained from LGC-Dr Ehrenstorfer (LGC Standards, Barcelona, Spain) and 4-Hydroxy-4-(3-pyridyl)-butyric acid (HPBA ...
-
No products found
because this supplier's products are not listed.
Irène Amblard, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Furimazin (1/500) was added to live cells and luciferase activity of the internalized protein was measured on a plate reader (Tristar, Berthold).
-
No products found
because this supplier's products are not listed.
Brynna S. Eisele, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The volume of concentrated samples was adjusted to 70 ul and 3 ul of Chondroitinase ABC (1.4 U/ml Stock solution, containing BSA, Seikagaku) was added to each sample ...
-
No products found
because this supplier's products are not listed.
Fenghua Qian, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 10 ng/mL mrIL-3 (Gemini bio-products), and 10 ng/mL mrIL-6 (Gemini bio-products) ...
-
No products found
because this supplier's products are not listed.
Aubin Ramon, et al.,
bioRxiv - Bioengineering 2023
Quote:
... SarS-CoV-2 RBD was purchased as biotinylated purified protein from CUSABIO (product code CSB-MP3324GMY1-B) and stored at -80 °C.
-
No products found
because this supplier's products are not listed.
Cathleen P Jewell, et al.,
bioRxiv - Evolutionary Biology 2019
Quote:
... The antibody was prepared against the synthetic peptide LEANEIHNTELNNPTLQKKGGC-amide (21st Century Biochemicals), as described previously (Tovar-Méndez ...
-
No products found
because this supplier's products are not listed.
Benjamin H Gern, et al.,
bioRxiv - Immunology 2019
Quote:
... Antibody detection was performed using species specific polymer HRP-conjugated systems (GBI Labs) coupled with tyramide signal amplification (TSA ...
-
No products found
because this supplier's products are not listed.
Jaqueline S. Generoso, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rabbit polyclonal anti-capsule serotype 3 antiserum (SSI Diagnostica) followed by Alexa Fluor 594 goat anti-rabbit (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Hammam Antar, et al.,
bioRxiv - Biochemistry 2021
Quote:
... CTP/parSDNA 40 pre-mix (10 μL) was added to protein solution (10 μL) using BenchSmart 96 (Rainin) dispenser robot and mixed by pipetting ...
-
No products found
because this supplier's products are not listed.
Ravendra Garg, et al.,
bioRxiv - Cancer Biology 2020
Quote:
The antibody lintuzumab was conjugated to the bifunctional chelator p-SCN-Bn-DOTA (Macrocyclics) by methods described previously with some modifications 21 ...
-
No products found
because this supplier's products are not listed.
Mari Akiyma,
bioRxiv - Cell Biology 2020
Quote:
... Alkaline phosphatase-tagged antibody was visualized with PermaRed/AP (K049, Diagnostic BioSystems, CA, USA). Incubation with mouse monoclonal antibodies for osteocalcin (diluted 1:100 ...
-
No products found
because this supplier's products are not listed.
Xiaodan Zhang, et al.,
bioRxiv - Genomics 2021
Quote:
... The slide was then incubated with rabbit anti-mouse Lyve1 primary antibody (1:25, AngioBio cat.no ...
-
PRG-3 and Attachment Factor™ are engineered to work together to stabilize the cell membrane and...
Cat# 4Z0-410,
100.0 mL, $82.0
Ask
Guneet Kaur, et al.,
bioRxiv - Neuroscience 2023
Quote:
Primary human cerebral cortex microvascular endothelial cells (Passage 3, 12 CPD in vitro, ACBRI 376) were procured from Cell Systems (Kirkland, WA 98034, USA). Brain microvascular endothelial cells (BMECs ...
-
No products found
because this supplier's products are not listed.
Tiberiu Loredan Stan, et al.,
bioRxiv - Genetics 2023
Quote:
Protein was isolated from muscle samples by homogenizing the muscles in 1.4 mm Zirconium Beads prefilled tubes (OPS Diagnostics; Lebanon, USA), containing 100 mM Tris-HCl (pH 6.8 ...
-
No products found
because this supplier's products are not listed.
Sultan Ahmed, Panashe Mabeza, Derek T Warren,
bioRxiv - Cell Biology 2019
Quote:
Human adult aortic VSMCs (passage 3-10) were purchased from Cell Applications Inc (Isolate-1) ...
-
No products found
because this supplier's products are not listed.
Selena Y. Lin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... PG donors 3 and 4 had only plasma obtained by Lee Biosolution. In this case ...
-
No products found
because this supplier's products are not listed.
Sandro Roier, et al.,
bioRxiv - Immunology 2023
Quote:
... The protein vaccines were alum-adjuvanted by adsorption of the recombinant fusion proteins to aluminum hydroxide (Alhydrogel®; Croda, Frederikssund, Denmark) as previously described22 ...
-
No products found
because this supplier's products are not listed.
Jie Zhu, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and Piccolo (Anti-Antibody [6H9-B6] and StressMarq Biosciences INC; Anti-Piccolo antibody (ab20664) Abcam ...
-
No products found
because this supplier's products are not listed.
Aritra Nath Kundu, et al.,
bioRxiv - Bioengineering 2023
Quote:
... for 3 hours at room temperature in a peptide synthesis vessel (ChemGlass, Vineland, NJ). The peptide solution was filtered to remove the resin and the peptide was precipitated out using diethyl ether at -80°C ...
-
No products found
because this supplier's products are not listed.
Tongtong Li, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... and FLAG antibody (Zen-Bio, Chengdu, China) were used to detect the proteins.
-
No products found
because this supplier's products are not listed.
Gary Reynolds, et al.,
bioRxiv - Immunology 2020
Quote:
... then resuspended in 200 μl of flow buffer per 106 cells with 3 μM DAPI (Sysmex Partec, 05-5005). Cells were then run through a Fortessa X20 for analysis ...
-
No products found
because this supplier's products are not listed.
Zhaoyang Liu, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Histological analysis was performed on thoracic spines fixed in 10% neutral-buffered formalin for 3 days at room temperature followed by 1-week decalcification in Formic Acid Bone Decalcifier (Immunocal, StatLab). After decalcification ...
-
No products found
because this supplier's products are not listed.
Dinesh Devadoss, et al.,
bioRxiv - Physiology 2020
Quote:
... Culture supernatants were collected on day 3 and p24 antigen levels were determined using p24 ELISA (ZeptoMetrix Corp. Cat # 0801200) as per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Peter K. Kim, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Oligo HA (5kDa) was obtained from Lifecore Biomedical. Two different LMW HA were used in this study ...
-
No products found
because this supplier's products are not listed.
Esther Sweeney, et al.,
bioRxiv - Microbiology 2019
Quote:
... 500 μl of ASM 20 μg ml-1 ampicillin was added to each well and the plate was sealed with a Breath-Easier membrane (Diversified Biotech). Plates were incubated at 37 °C for up to 7 days and refreshed with 300 μl of ASM 20 μg ml-1 ampicillin at 48 h if appropriate ...
-
No products found
because this supplier's products are not listed.
Felix J. Flomm, et al.,
bioRxiv - Microbiology 2022
Quote:
... The gradient was made with a Gradient Master (BioComp Instruments) for an SW41 rotor ...
-
No products found
because this supplier's products are not listed.
Steven T. Denham, et al.,
bioRxiv - Microbiology 2022
Quote:
... Platelet depletion efficiency was determined by Hemavet 950FS (Drew Scientific Group) analysis of blood collected by cheek bleed 10 minutes prior to anti-GPIbα administration and on the day of inoculation.
-
No products found
because this supplier's products are not listed.
Derek L. Wise, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the brain was cut using a compresstome (Precisionary Instruments, Greenville, NC) in filtered ice-chilled artificial cerebrospinal fluid (ACSF ...