Labshake search
Citations for Takara Bio :
1 - 50 of 6771 citations for WAS Protein Family Member 3 WASF3 Antibody Biotin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: The 5’UTR promoter region of mouse L1Spa belonging to LINE-1 Tf family was amplified with the primers (Fw; AATGGGCAGAGCTCGTTTAG, Rv: CTGGTAATCTCTGGAGTTAG) and Takara LA Taq polymerase with GC buffer (Takara Bio) using pTN201 plasmid (a kind gift from Dr ...
-
bioRxiv - Plant Biology 2020Quote: ... the YFP protein was detected using the GFP antibody (Clontech) at 1/5,000th and the UGPase antibody (Agrisera ...
-
Osh6 requires Ist2 for localization to the ER-PM contacts and efficient phosphatidylserine transportbioRxiv - Cell Biology 2020Quote: For testing protein-protein interactions Matchmaker™ GAL4 Two-Hybrid System 3 was used according to the manufacturer’s instructions (Clontech). Briefly ...
-
bioRxiv - Cell Biology 2023Quote: ... Expression level of Venus and Venus-tagged arrestin-3 proteins was determined with anti-GFP JL-8 antibody (#632381, Takara Bio USA, San Jose, CA). The endogenous β-actin (loading control ...
-
bioRxiv - Plant Biology 2020Quote: ... YFP-CESA6 protein was detected using anti-GFP antibody (Takara, catalog # 632381) and SEC12 was detected using anti-SEC12 antibody (Bar-Peled and Raikhel ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Genetics 2022Quote: ... Total protein was harvested after 3 days of culture and analyzed by Western blot (mouse anti-DsRed, Clontech; rabbit anti-POU6F2 ...
-
bioRxiv - Neuroscience 2023Quote: ... Red Fluorescent Protein Antibody (DsRed, 1:500, Clontech). The brain sections were incubated with antibodies in blocking solution at 4°C temperature overnight ...
-
bioRxiv - Microbiology 2022Quote: ... Membrane was immunoblotted for ≥ 3 h with primary monoclonal anti-GFP (1:5,000) antibodies (JL8, Clontech-Takara), then followed by immunoblotting for ≤ 1 h with secondary antibodies ...
-
bioRxiv - Microbiology 2022Quote: ... Membrane was immunoblotted for ≥ 3 h with primary monoclonal anti-GFP (1:5,000) antibodies (JL8, Clontech-Takara), then followed by immunoblotting for ≤ 1 h with secondary antibodies ...
-
bioRxiv - Immunology 2022Quote: 5’ and 3’ RACE was performed with SMARTer RACE 5’/3’ Kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3’ RACE was performed using 3’-Full RACE Core Set (TaKaRa, Kusatsu, Japan). PCR amplification on the 3’ UTR regions of AtCFI25a ...
-
bioRxiv - Neuroscience 2023Quote: ... Green Fluorescent Protein (GFP) antibody (JL-8, 1:500, Clontech), Red Fluorescent Protein Antibody (DsRed ...
-
bioRxiv - Developmental Biology 2022Quote: ... The expression of Dunk protein was confirmed by Western blot using c-Myc Monoclonal Antibody (Takara, Cat# 631206). Then ...
-
bioRxiv - Zoology 2021Quote: ... The 3′-RACE assay was performed using the SMARTer RACE 5′/3′ Kit (CA94043, TaKara) following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2022Quote: The 3’end of the cloned fragment was amplified with a 3’RACE kit (Takara). RNA from fresh soybean roots was used as the template ...
-
bioRxiv - Molecular Biology 2023Quote: ... Equal loading of the GFP tagged E2F1 proteins was determined by the GFP antibody (Clontech, lot. 1404005; 1:2000) the secondary antibody anti-rabbit HRP (Na934v ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing the 5’ end was used and the 3’ of TciALDO cDNA was obtained by 3’ RACE (SMARTer RACE cDNA Amplification Kit, Clontech) using T ...
-
bioRxiv - Microbiology 2019Quote: ... and 5’- or 3’-RACE was performed with SMARTer®RACE 5’/3’ Kit (Takara, 634858) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Protein concentration was measured using the BCA Protein Assay Kit (Takara Bio). The protein samples were subjected to SDS-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membranes using the Trans-Blot Turbo Transfer System (Bio-Rad) ...
-
bioRxiv - Microbiology 2022Quote: ... The protein concentration was determined by a BCA protein assay kit (TakaRa) using bovine serum albumin (BSA ...
-
bioRxiv - Physiology 2022Quote: ... Protein concentration was determined using the BCA protein assay kit (Takara Bio).
-
bioRxiv - Molecular Biology 2022Quote: ... protein was estimated using BCA (TaKaRa), and 100 µg protein was incubated with 20 µl packed protein G-sepharose beads (Sigma P3296 ...
-
bioRxiv - Cancer Biology 2020Quote: ... the TET protein expression in each clone was checked by immunoblotting using TetR monoclonal antibody (Clone 9G9) (Clontech, cat#631131). In addition ...
-
bioRxiv - Plant Biology 2022Quote: ... CITRINE-fusion proteins were detected with anti-GFP antibody (JL-8, Takara Bio Clontech ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’ multiplexed RNA-sequencing was performed with the Takara SMART-Seq v4 3’ DE Kit (Takara 635040) followed by Nextera XT (Illumina FC-131-1024 ...
-
bioRxiv - Microbiology 2023Quote: ... Protein concentration was quantified using the BCA protein assay kit (Takara Bio, T9300A). Cell lysates (about 200 µl ...
-
bioRxiv - Neuroscience 2022Quote: ... protein lysate was immunoprecipitated for 2 h at 4°C with the following antibodies: mouse anti-GFP (1:1000; Takara Bio), mouse anti-FLAG (1:1000 ...
-
bioRxiv - Biochemistry 2021Quote: ... Protein was purified using Talon resin (Clontech), eluted in 200 mM imidazole ...
-
bioRxiv - Zoology 2020Quote: ... The protein concentration was measured by TaKaRa BCA Protein Assay Kit (Takara Bio ...
-
bioRxiv - Molecular Biology 2019Quote: ... and protein was incubated with Talon (Clontech), 0.5 ml resin per litre cell culture for 1 h at 4°C ...
-
bioRxiv - Biophysics 2022Quote: ... 3’-RACE-Ready cDNA template was synthesized using a SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and subsequently used to amplify 3’ end sequences of R ...
-
bioRxiv - Cancer Biology 2022Quote: ... The protein concentration was determined using the BCA protein assay kit (TaKaRa, Shiga, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... The protein concentration was quantified using the TaKaRa BCA Protein Assay Kit (TaKaRa, Japan), and 2-mercaptoethanol (Nacalai Tesque ...
-
bioRxiv - Cell Biology 2019Quote: ... a pFA6a-3’UTR-AfeI-5’UTR-scd2-kanMX-3’UTR (pSM2255) plasmid was generated by InFusion cloning (Clontech) of a pFA6a-based plasmid containing the yeast kanMX resistance cassette digested with KpnI and AscI ...
-
bioRxiv - Plant Biology 2022Quote: CRISIS2 or Nb14-3-3 was fused with the Gal4 DNA binding domain in pGBKT7 (Clontech, PT3248-5, USA) and inserted into the Saccharomyces cerevisiae Y2HGold strain (Clontech ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The 3’-RACE PCR was performed with ExTaq polymerase (TaKaRa) using the following primers ...
-
bioRxiv - Biochemistry 2021Quote: ... monoclonal antibody for green fluorescent protein (JL-8; Takara Bio, Kusatsu, Japan; recognizes VC), rabbit anti-GFP (D5.1 Cell Signaling Technology 2956S ...
-
bioRxiv - Plant Biology 2022Quote: ... CITRINE-fusion proteins were detected with anti-GFP antibody (JL-8, Takara Bio Clontech, dilution ...
-
bioRxiv - Plant Biology 2021Quote: ... GFP-tagged proteins were detected using the anti-GFP antibody (JL-8, Clontech Takara) diluted 1:2000 (v/v ...
-
bioRxiv - Plant Biology 2021Quote: ... GFP-tagged proteins were detected using the anti-GFP antibody (JL-8, Clontech Takara) diluted 1:2000 (v/v ...
-
bioRxiv - Molecular Biology 2023Quote: ... GFP fusion proteins were revealed with mouse monoclonal antibody anti-GFP (JL-8, Clontech) used at 1/2000 dilution ...
-
bioRxiv - Cell Biology 2022Quote: ... Total protein was quantified using the TAKARA BCA Protein Assay Kit (TAKARA Bio Inc., Japan). Equal amounts of protein were separated by SDS-PAGE on 10% gels ...
-
bioRxiv - Genomics 2020Quote: ... CAS9 protein was purchased from Clontech (Cat # 632641). For injection ...
-
bioRxiv - Biochemistry 2021Quote: ... Protein was purified using amylose-agarose resin (Clontech) and eluted in 10 mM maltose ...
-
bioRxiv - Biochemistry 2020Quote: ... Protein concentration was determined by Bradford assay (TAKARA). Nickel affinity purification of 10His-SUMO1T95R conjugates was carried out with Ni-NTA agarose beads (Qiagen) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The protein was purified by TALON affinity (Clontech), HiTrap-Q anion-exchange (Cytiva ...
-
bioRxiv - Cell Biology 2020Quote: The full-sized Not (aa 496) was PCR-amplified using primers 5’-ttgaattcatgtccgagacgggttgtc-3’ and 5’-ttgtcgacttactcgtattccagcacatt-3’ and subcloned into pGBT9 vector (Clontech) in frame with DNA-binding domain of GAL4 using restriction sites EcoRI and Sal1.
-
bioRxiv - Cell Biology 2020Quote: The full-sized CP190 (aa 1096) was PCR-amplified using primers 5’-ttcccgggcatgggtgaagtcaagtccg-3’ and 5’-tttggaggagctatatttactaagatct-3’ and subcloned into pGAD424 vector (Clontech) in frame with activation domain of GAL4 using restriction sites SmaI and BamHI ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR amplification was carried out with primers (Forward: 5’-AGGCAGTGAGTGAAGTGT -3’, Reverse: 5’-TAAGTTGGCGAGGCTTGA -3’) using PrimeSTAR HS DNA Polymerase (DR010A, Takara) under the following conditions ...