-
No products found
because this supplier's products are not listed.
Sara Expósito, et al.,
bioRxiv - Neuroscience 2024
Quote:
... and 8-Chloro-11-(4-methyl-4-oxido-1-piperazinyl)-5H-dibenzo[b,e][1,4]diazepine (CNO) were purchased from Tocris. 8-Cyclopentyl-1,3-dimethylxanthine (CPT) ...
-
No products found
because this supplier's products are not listed.
Joseph Mills, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 3-(2-Methyl-5-nitro-imidazol-1-yl)-N-(2,2,2-trichloro-1-phenylamino-ethyl)-propionamide) (Sigma-Aldrich SML1503). Drugs were diluted in culture media at treatment.
-
No products found
because this supplier's products are not listed.
Basila Moochickal Assainar, et al.,
bioRxiv - Biophysics 2023
Quote:
... 0.5% NBD-PC (1-palmitoyl-2-(6-[(7-nitro-2-1,3-benzoxadiazol-4-yl)amino]hexanoyl)-sn-glycero-3-phosphocholine (Avanti Polar Lipids, Inc.)) ...
-
No products found
because this supplier's products are not listed.
Tzu-Yu Feng, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... anti-PDGF-B (F-3, Santa Cruz), anti-GAPDH antibody (6C5 ...
-
No products found
because this supplier's products are not listed.
Supanat Phuangphong, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... Nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (Roche) and Fast Red (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Timothy Q. Vu, Lucas E. Sant’Anna, Neha P. Kamat,
bioRxiv - Bioengineering 2022
Quote:
... 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-(7-nitro-2-1,3-benzoxadiazol-4-yl) (16:0 NBD) were purchased from Invitrogen. Phosphate-buffered saline (PBS ...
-
No products found
because this supplier's products are not listed.
Helen Carrasco Hope, et al.,
bioRxiv - Immunology 2020
Quote:
... T cells were cultured with 2-deoxy-2-((7-nitro-2, 1, 3-benzooxadiazol-4-yl)amino)-glucose (2-NBDG) (Abcam 50μM, 1h), 4 ...
-
No products found
because this supplier's products are not listed.
Irene Julca, et al.,
bioRxiv - Plant Biology 2022
Quote:
... The medium was aspirated and fresh medium containing 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, premixed in 5:1 ratio, Promega) was added to the treated cells ...
-
No products found
because this supplier's products are not listed.
Krzysztof Mikołajczyk,
bioRxiv - Biochemistry 2024
Quote:
... and untransfected cells were cultured for 2 weeks in a complete medium containing 3 μM N-[(1R,2R)-1- (2,3-dihydro-1,4-benzodioxin-6-yl)-1-hydroxy-3-pyrrolidin-1-ylpropan-2-yl]nonanamide (Genz-123346) (Merck, Darmstadt, Germany), a glucosylceramide synthase inhibitor [26].
-
No products found
because this supplier's products are not listed.
Thomas C. Harper, et al.,
bioRxiv - Immunology 2023
Quote:
... 5 ng/ml IL-11 (PeproTech, 200-11), 25 ng/ml IGF-1 (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Roza Izgilov, et al.,
bioRxiv - Cell Biology 2023
Quote:
using a fluorescent glucose analog, 2-NBDG (2-Deoxy-2-[(7-nitro-2, 1, 3-benzoxadiazol-4-yl) amino]-D-glucose) (11046, Cayman chemical). Cultured 3T3-L1 cells “starved” in a glucose-free medium at 37°C for 1 hr ...
-
No products found
because this supplier's products are not listed.
Sébastien Meurant, et al.,
bioRxiv - Cell Biology 2024
Quote:
... The mutagenesis primers for the addition of the STOP codon at the end of the MPV17 gene from MPV17-HA plasmid (F: 5’-TAATCTAGAATGTACCCATACGATGTTC-3’; R: 5’-GAGCCGATGTGCCTTCCA-3’) were generated using the NEBaseChanger bioinformatic tool (NEB). The mutation was confirmed and the plasmids were validated using Sanger sequencing (Eurofins Discovery).
-
No products found
because this supplier's products are not listed.
Phillip Zhu, et al.,
bioRxiv - Biochemistry 2022
Quote:
... The 3-nitro-tyrosine incorporation plasmid (pAcBac1-3-nitroTyr-A7, Addgene # 141173) was as previously described.35
-
No products found
because this supplier's products are not listed.
Pattana Jaroenlak, et al.,
bioRxiv - Microbiology 2024
Quote:
... 1 μl of TotalSeq™ B anti-human hashtag antibodies 5-10 (BioLegend, USA) was added into the cell suspensions collected from each infection time point and incubated for 20 min at 4°C ...
-
No products found
because this supplier's products are not listed.
Julie C. Worrell, et al.,
bioRxiv - Immunology 2024
Quote:
... or anti-CD45-PE (BD, 30-F.11) or anti-CD45 eflour450 (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Anne D. Villela, et al.,
bioRxiv - Microbiology 2020
Quote:
... Membranes were washed three times with 1X PBS for 5 min and developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in alkaline phosphatase buffer (Bio-Rad).
-
No products found
because this supplier's products are not listed.
Christopher Douglas, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... HGF (5’-CTCACACCCGCTGGGAGTAC-3’, 5’-TCCTTGACCTTGGATGCATTC-3’), STAT3 (5’-CTTTGAGACCGAGGTGTATCACC-3’, 5’-GGTCAGCATGTTGTACCACAGG-3’) and B-Actin Primer Set (Qiagen, QT00095431). After preparing master mixes samples were prepared in quadruplicate in a 96-well Reaction Microplates (Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Ahmed Lazrak, et al.,
bioRxiv - Physiology 2022
Quote:
... DMEM/F-12 medium (Corning, 11-320-033); Keratinocyte SFM (Gibco ...
-
No products found
because this supplier's products are not listed.
Clément Blot, et al.,
bioRxiv - Microbiology 2023
Quote:
The ROS production by macrophages was measured by chemiluminescence in the presence of 5-amino-2,3-dihydro-1,4-phthalazinedione (luminol) using a thermostatically (37°C) controlled for 1 hr (Envision, PerkinElmer). For nitrite release ...
-
No products found
because this supplier's products are not listed.
He-Yun Hsiao, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... we employed the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) or WST-1 (Water-Soluble Tetrazolium 1) assay from Takara, Japan ...
-
No products found
because this supplier's products are not listed.
Gina Partipilo, et al.,
bioRxiv - Bioengineering 2024
Quote:
... disodium;4-[3-pyridin-2-yl-6-(4- sulfonatophenyl)-1,2,4-triazin-5-yl]benzenesulfonate hydrate (Ferrozine, VWR) All media components were autoclaved or sterilized using 0.2 μm PES filters.
-
No products found
because this supplier's products are not listed.
Valentina Fajner, et al.,
bioRxiv - Animal Behavior and Cognition 2020
Quote:
... CG42797EcoRI_F: 5’-CCGgaattcATGGAGCCACCAGCT-3’ and CG42797XhoI_Nterm_R: 5’-CCGctcgagTCATTCGCTGGGCTGC-3’ and cloned by enzymatic digestion into a pGEX6P1(GE Healthcare).
-
No products found
because this supplier's products are not listed.
Kristel Martinez Lagunas, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Hygromycin-B (Invivogen, ant-hg-1/5), Neomycin (Invivogen ...
-
No products found
because this supplier's products are not listed.
Elizabeth M Avegno, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2,3-Dioxo-6-nitro-1,2,3,4-tetrahydrobenzo[f]quinoxaline-7-sulfonamide (NBQX; 10 μM; R&D Systems) was then added to determine the effect of AMPA receptor blockade on ePSCs ...
-
No products found
because this supplier's products are not listed.
Yun Deng, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... with 5-bromo-4-chloro-3-indolyl-phosphate nitro blue tetrazolium staining (Vector Laboratories, Burlingame, CA, USA). 10 ∼ 30 embryos were used for each probe ...
-
No products found
because this supplier's products are not listed.
Rebecca J. Hall, et al.,
bioRxiv - Microbiology 2023
Quote:
... The 5 ml overnight culture was centrifuged at 8,000 rpm (Eppendorf MiniSpin F-45-12-11) for three minutes ...
-
No products found
because this supplier's products are not listed.
Ci Zhu, et al.,
bioRxiv - Molecular Biology 2021
Quote:
Splenocytes from LCMV clone13-infected mice were isolated and incubated with gp33-41 peptide (0.4μg/mL) for 5h at 37 °C in the presence of CD107a/b Ab and stained with the phospho-RPS6 (Cell Signaling) anti-IFN-γ and anti-TNF-α Abs (BD ...
-
No products found
because this supplier's products are not listed.
Elvin Wagenblast, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Between 1×10^3 – 5×10^4 cells were re-suspended in 20μl Buffer P3 (Lonza) per reaction and quickly added to the Eppendorf tube containing the CRISPR/Cas9 gRNA RNP complex ...
-
No products found
because this supplier's products are not listed.
Brigita E. Fiske, et al.,
bioRxiv - Immunology 2024
Quote:
... B cells were stimulated with 10 μg/mL F(ab’)2 goat anti-mouse IgM (anti-μ) (Jackson ImmunoResearch). At the indicated times ...
-
No products found
because this supplier's products are not listed.
Crozat Elysa, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 10 or 11 software (Molecular Devices). Series resistance (10-20 MΩ ...
-
No products found
because this supplier's products are not listed.
Arka Banerjee, et al.,
bioRxiv - Molecular Biology 2023
Quote:
E14 and RPL39L KO cells were treated for 5h at 37°C and 5% CO2 with 10μM (S)-MG132 (STEMCELL Technologies Catalog #73264) and 5μM Bafilomycin-A1 (STEMCELL Technologies Catalog #74242 ...
-
No products found
because this supplier's products are not listed.
Jitu W. George, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... ALKBH5 (11:1000; 6837-1-AP; Proteintech), and β-actin (1:5000 ...
-
No products found
because this supplier's products are not listed.
Paraskevi Athanasouli, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
No products found
because this supplier's products are not listed.
Dan Xia, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Mobile phase B consisted of acetonitrile:water 9:1 with 10 mM ammonium acetate + 5 μM medronic acid (Agilent), pH 9 ...
-
No products found
because this supplier's products are not listed.
Amaya Urdánoz-Casado, et al.,
bioRxiv - Genetics 2021
Quote:
Assessment of Aβ deposition was carried out by immunohistochemical staining of paraffin-embedded sections (3–5 μm-thick) with a mouse monoclonal (S6 F/3D) anti-Aβ antibody (Leica Biosystems Newcastle Ltd ...
-
No products found
because this supplier's products are not listed.
Lisa M. Russo, et al.,
bioRxiv - Microbiology 2021
Quote:
... 10-11 week old Swiss Webster female mice (Charles River) were vaccinated intraperitoneally three times at two week intervals ...
-
No products found
because this supplier's products are not listed.
Alexander Kapustin, et al.,
bioRxiv - Cell Biology 2023
Quote:
... CD81 (BD Pharmingen™, 555676, B-11, SantaCruz, sc-166029 and M38 clone, NBP1-44861, Novus Biologicals), Syntenin-1 (Abcam ...
-
No products found
because this supplier's products are not listed.
John K. Mich, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the following primers were used: (5’-GGTTTCCCGCAGAACCTGAA-3’) and (5’-CCATCGCTCGACCAGTTTAGT-3’) (Jackson Laboratories)
-
No products found
because this supplier's products are not listed.
Valentina Gandin, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... using the following two primer sequences (T7 Forward: 5’-TAATACGACTCACTATAGCGTCATC-3’; Reverse: 5’-TTGTCGCACGTTCGGTGTCG-3’) and purified with DNA Clean and Concentrator-5 Kit (Zymo Research, 11-302). dsDNA was converted to RNA with HiScribe™ T7 High Yield RNA Synthesis Kit (NEB ...
-
No products found
because this supplier's products are not listed.
Chotiwat Seephetdee, et al.,
bioRxiv - Immunology 2022
Quote:
... A total of 500,000 splenocytes were restimulated ex vivo with the full-length SARS-CoV-2 B.1.1.529 S 15-mer (overlapping by 11 amino acids) peptide pool (GenScript) in plates pre-coated with anti-IFN-γ or anti-IL-4 antibodies ...
-
No products found
because this supplier's products are not listed.
Susanta Chatterjee, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and the cleared supernatant was loaded on a 3 to 30% iodixanol gradient (OptiPrep) and ultracentrifuged for 5h at 36,000 rpm in an SW60 rotor (Beckman Coulter). Fractions were collected manually through aspiration and RNA or proteins were isolated for further analysis.
-
No products found
because this supplier's products are not listed.
Lunhua Liu, Kazuyo Takeda, Mustafa Akkoyunlu,
bioRxiv - Immunology 2020
Quote:
Splenic B cells were isolated from 5 or 12 weeks old MRL/Lpr mice using B Cell Isolation Kit (Miltenyi Biotec) and stained with CSFE before co-culturing with purified TCRβ+CD138+ or TCRβ+CD138− cells in the presence of anti-CD3/CD28 antibodies (BD Biosciences) ...
-
No products found
because this supplier's products are not listed.
Yasunori Watanabe, et al.,
bioRxiv - Microbiology 2021
Quote:
... after receiving 1 μl of 5× concentrated 10 nm Au fiducial solution (EMS) in the back-side and being blotted from the back ...
-
No products found
because this supplier's products are not listed.
Jordan Clark, et al.,
bioRxiv - Immunology 2024
Quote:
... Cells were incubated at 37°C in a 5% CO2 incubator for 3 days and fixed with 10% paraformaldehyde (Polysciences) for 24 hours ...
-
No products found
because this supplier's products are not listed.
Parya Behzadi, et al.,
bioRxiv - Physiology 2024
Quote:
... membranes were stripped in 1 × NewBlot Nitro Western Blot Stripping Buffer (LI-COR, Lincoln, NE) for 10 min ...
-
No products found
because this supplier's products are not listed.
Nina R. Montoya, et al.,
bioRxiv - Microbiology 2022
Quote:
... The plates were developed with TMB (3, 3’, 5, 5’ - Tetramethylbenzidine) ELISA Peroxidase Substrate (Rockland Immunochemical, Limerick, PA), and absorbance was measured on a plate reader at 655 nm.
-
No products found
because this supplier's products are not listed.
Issa Olakunle Yusuf, et al.,
bioRxiv - Neuroscience 2020
Quote:
... including MAP2A/B (Genetex; 1:500 dilution), βIII-tubulin (Genetex ...
-
No products found
because this supplier's products are not listed.
Kristin Metzdorf, et al.,
bioRxiv - Immunology 2022
Quote:
... 3 μm thick FFPE sections were stained for SARS-CoV-2 with mouse-anti-nucleocapsid CoV-1/2 (Synaptic Systems, HS-452 11, clone 53E2, subtype: IgG2a) and for macrophages with rat-anti-mouse-MAC2 (Biozol Diagnostica/CEDARLANE,CL8942AP ...
-
No products found
because this supplier's products are not listed.
Deepak Timalsina,
bioRxiv - Plant Biology 2020
Quote:
... 11 (Epoch2, BioTek, Instruments, Inc., USA).
-
No products found
because this supplier's products are not listed.
Benjamin N. Bell, et al.,
bioRxiv - Immunology 2021
Quote:
RBD antigen binding during selection rounds 3 and 5 was evaluated using a 1:1000 dilution of rabbit anti-His FITC secondary antibody (Bethyl Laboratories). RBD antigen binding during selection Round 4 was evaluated using a 1:1000 dilution of Streptavidin-Alexa Fluor 647 secondary (Jackson ImmunoResearch) ...