Labshake search
Citations for GenScript :
1 - 50 of 864 citations for 1 3 Nitro 10 11 dihydro 5H dibenzo b f azepin 5 yl ethanone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... A total of 500,000 splenocytes were restimulated ex vivo with the full-length SARS-CoV-2 B.1.1.529 S 15-mer (overlapping by 11 amino acids) peptide pool (GenScript) in plates pre-coated with anti-IFN-γ or anti-IL-4 antibodies ...
-
bioRxiv - Plant Biology 2024Quote: ... Guide RNA sequences “5-CGUGUCACGACGGAGUGGAU-3” and “5-AUGUUGUAUGUGCCUAUACG-3” were synthesized by GenScript by adding the Cas12a scaffold sequence (5-UAAUUUCUACUCUUGUAGAU-3 ...
-
bioRxiv - Biophysics 2024Quote: ... coli and cloned into the 5’BamHI and 3’XhoI sites of pGEX6P-1 (GenScript).
-
bioRxiv - Synthetic Biology 2024Quote: ... LNP #3 (ALC0315) and LNP #4 (LP01) encapsulating f-luciferase mRNA also were provided by Genscript.
-
bioRxiv - Genetics 2021Quote: ... sequences flanked by overhangs for Gibson Assembly matching the vector insertion site (5’-CCGCATGCTTAATTAAGAAGGAGATATACAT-3’) – array sequence – (5’-GACTACAAGGATGACGACGACAAG-3’) were synthesized (Genscript) and obtained in a pUC57-Kan vector ...
-
bioRxiv - Cancer Biology 2021Quote: CerS5 and CerS6 knock-out clones of DLD-1 cells were generated using the LentiCRISPR v2.0 system with guide RNAs (gRNAs; CerS5; 5’-GCTTGTCCTGATTCCTCCGA-3’ and CerS6; 5’-GGCTCCCGCACAATGTCACC-3’) purchased from GenScript (Piscataway, NJ USA). DLD-1 cells were transiently transfected using Lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... pLentiCRISPR v2 plasmids that contained predesigned guide RNA targeting mouse ATP2C1 (KO, 5′-TGATGCCGTCAGTATCACTG-3′) and scrambled control guide RNA (SCRM, 5’- AAACCAAAGAGCCGAAGAAC-3’) were obtained from GenScript (Piscataway, NJ). These plasmids were then transfected into Min6 using Lipofcetamin 3000 (Invitrogen) ...
-
bioRxiv - Biochemistry 2024Quote: ... The FAM-labeled fluorescent FTH-1 IRE probe with the sequence 5’- UCCUGCUUCAACAGUGCUUGGACGGAAC-3’ was prepared by GenScript Biotech (Netherlands) ...
-
bioRxiv - Biochemistry 2024Quote: ... The RNA (5’-UCGCUUGGUGCAGAUCGGGAC-3’) labeled at the 5’ end with FAM was synthesized by Genscript co. ...
-
bioRxiv - Immunology 2020Quote: ... with complete RPMI (10%FBS, 1% Pen/Strep, 50uM b-mercaptoethanol) supplemented with 1ug/ml OVA Peptide (323-339) (Genscript, Cat. No. RP10610) (DAY0) ...
-
bioRxiv - Microbiology 2021Quote: ... using primary antibodies specific for MeV F HRC (rabbit polyclonal, Genscript, 503028-1) and 6xHis tag (rabbit polyclonal ...
-
bioRxiv - Microbiology 2021Quote: ... using primary antibodies specific for MeV F HRC (rabbit polyclonal, Genscript, 503028-1) and 6xHis tag (rabbit polyclonal ...
-
bioRxiv - Microbiology 2020Quote: Human EnvP(b)1 codon-optimized sequence was ordered from GenScript. EnvP(b)1 sequences from chimpanzee ...
-
bioRxiv - Immunology 2020Quote: ... derived from a peptide scan [15-mers with 11 amino acid overlap] through Spike glycoprotein of SARS-CoV-2) (JPT, Cat: PM-WCPV-5 or GenScript, Cat: RP30020). Phorbol Myristate Acetate (PMA ...
-
bioRxiv - Plant Biology 2021Quote: cDNA stretches corresponding to the 3’ UTR region of TCV genomic RNA (5’-CAACUGAGGAGCAGCCAAAGGGUAAAUUGCAAGCACUCAGAAU-3’) were obtained from GenScript [26] ...
-
bioRxiv - Microbiology 2022Quote: ... Delta (B.1.617.2) and Omicron (B.1.1.529) were synthesized by GenScript. The production of SARS-CoV-2 S pseudotyped vesicular stomatitis virus (VSV ...
-
bioRxiv - Immunology 2020Quote: ... plasmid that contained predesigned guide RNA targeting Adar1 (5’-CTTGTCCGTCAAGTACCAGA-3’) and a pLentiCRISPR v2 plasmid that contained predesigned guide RNA targeting Adar2 (5’-AGTACCGCCTGAAGAAGCGA-3’) were obtained from GenScript. These plasmids were then transfected into Raw 264.7 cells using a Neon Transfection System (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2023Quote: ... either labeled with 5’ 6-carboxyfluorescein or unlabeled and reverse complement 14mer (5’-GACGUCCAUGUGCC-3’) were purchased from GenScript. The dsRNA was prepared by annealing the ss-14mer (5’-GGCACAUGGACGUC-3’ ...
-
bioRxiv - Microbiology 2021Quote: Plasmids encoding cDNA for hMPV 130-BV F and hMPV B2 F proteins were synthesized (GenScript) and cloned into the pcDNA3.1+ vector as previously described (29 ...
-
bioRxiv - Immunology 2022Quote: ... and 1-3 x 105 cells were stimulated for 24-48 hours with 11 SARS-CoV-2 Spike peptide pools (17- or 18-mers with 11 amino acid overlap) (Genscript, Piscataway, NJ) at a concentration of 1μg/mL per peptide ...
-
bioRxiv - Molecular Biology 2020Quote: ... The selected sgRNA with additional 20 bp RP-loop [5’TCTCCCTGAGCTTCAGGGAG-3’] at the 5’ end of guide RNA was custom synthesized by Genscript, cloned into plasmid pUC57 with unique restriction sites (Pcil ...
-
bioRxiv - Molecular Biology 2023Quote: Recombinant mouse interleukin-11 (rmIL11) (Z03052, Genscript, Oxford, UK) was dissolved in phosphate-buffered saline (PBS ...
-
bioRxiv - Plant Biology 2024Quote: Inceptin 11 (In11) peptide (ICDINGVCVDA) was synthesized (Genscript Inc.) and dissolved in water ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sangon Biotech) and RNA (5’-GCGUCGCAGGCCUUUUUAUU-3’; 0.39 mM, final concentration; GenScript Biotech Corp.) in 50 μL annealing buffer (5 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2022Quote: ... The genes for the designed HN protein variant 1 (HNv1) and F protein variant 1 (Fv1) were codon-optimized for expression in SJ and synthesized by Genscript® ...
-
bioRxiv - Immunology 2024Quote: ... HMPV F (54G10 monoclonal42 generated by Genscript).
-
bioRxiv - Evolutionary Biology 2020Quote: ... the primers g11S/g11AS covering target site sequence 11 (Figure 1A; Supplementary table 1) were synthesized by Genscript (www.genscript.com.cn) and combined by annealing ...
-
bioRxiv - Microbiology 2021Quote: LAD2 cells (3×105) were incubated with Spike-RBD protein (5 μg/mL, Genscript, Z03483) in adherent buffer (1mM CaCl2 ...
-
bioRxiv - Cell Biology 2023Quote: ... and the primers covering SNPs in the Cth (F- GAGCCTGGGAGGATATGAGA, R- AAGCTCGATCCAGGTCTTCA) and Ttc4 (F – GACAGGGCGGAACTATACCA, genes. qPCR products were Sanger sequenced using the GenScript Biotec Sanger sequencing service.
-
bioRxiv - Molecular Biology 2022Quote: ... Sangon Biotech) and RNA (5’-Cy5-ACGCGUCGCAGGCCU UUUUAUU-3’; 0.3 mM, final concentration; GenScript Biotech Corp.) in 50 μL annealing buffer (5 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2024Quote: ... or LV1-eGFP-miR-7 were generated by subcloning inserts from pAAV_hSYN1-eGFP-miR-7 and pAAV_hSYN1-eGFP (provided by Thomas B. Hansen) inside LV1 (immunodeficiency virus 1 (HIV-1)-based LV-PGK-GFP) backbone by GenScript Biotech Corporation ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.617 and B.1.1.7 variant Spikes were codon-optimized and synthesized by GenScript Inc (Nanjing ...
-
bioRxiv - Biochemistry 2020Quote: ... Xanthoxycyclin D and xanthoxycyclin F were purchased from GenScript Inc ...
-
bioRxiv - Biophysics 2020Quote: ... MEC-10 and DEGT-1 (GenScript) in the pGEM-HE oocyte expression vector (Liman et al. ...
-
bioRxiv - Microbiology 2021Quote: ... Lysed cells were denatured with SDS at 95°C for 5 min and separated on an 10% SDS PAGE (SurePAGE Bis-Tris, 10×8, GenScript, M00666) at 200V for 30 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
bioRxiv - Microbiology 2024Quote: ... The following gRNA sequence targeting ATF3 was cloned into pLentiCRISPRv2 plasmid: 5’-CCACCGGATGTCCTCTGCGC-3’ (Genscript, Clone ID C88007). HEK 293FT cells were co-transfected with pLentiCRISPRv2-ATF3 CRISPR gRNA ...
-
bioRxiv - Microbiology 2022Quote: ... 10^5 splenocytes were seeded and stimulated with peptides against S protein (From GenScript) (2μg/ml ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 10 μM ET-1/ IRL1620 (GenScript) for 1.5 h at room temperature (RT) ...
-
bioRxiv - Biochemistry 2024Quote: ... SWR1C was eluted by nutating resin in 1 mL B-0.1 with 0.5 mg/mL recombinant 3xFlag peptide (Genscript) for 1 hour twice in series ...
-
bioRxiv - Immunology 2021Quote: ... respectively) were synthesized (Supplementary Table 11) and cloned into the expression vector pET22b (GenScript). An interchain disulfide (CαCys158–CβCys171 in RLQ3 ...
-
bioRxiv - Biochemistry 2023Quote: ... A backbone vector containing the 3’ and 5’ segments of the Kv1.2 gene (including the UTR regions) in pUC57-Kan was ordered from Genscript. The final constructs were assembled using golden-gate cloning(52) ...
-
bioRxiv - Molecular Biology 2022Quote: ... pGEX4T-1-SUMO1-3 was designed by AJG and made by GenScript by cloning SUMO1-3 cDNA into BamHI and EcoR1 restriction sites ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 pM and 1 pM of flg22 (GenScript) were infiltrated in leaves with a needleless syringe ...
-
bioRxiv - Immunology 2022Quote: ... Omicron BA.1 and BA.5 was performed by GenScript, Nanjing ...
-
bioRxiv - Molecular Biology 2021Quote: ... plasmid (Addgene plasmid #48138)62 containing a guide RNA (5’-ACTGAGCTTGGATGCTTCTG-3’) and a donor plasmid containing 700 bp homology arms and a RPAC1 tag synthesised by GenScript into pUC57-Mini plasmid ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The resulting chimeric DNA sequence was flanked a 3’-BamHI and 5’-EcoRI sites and commercially synthesised (GenScript, Rijswijk, Netherlands) into vector pUC19 (pJGUC01) ...
-
bioRxiv - Microbiology 2022Quote: ... This codon-optimized version of dcas9 (Bbdcas9) was synthesized and cloned in pBluescript II KS (+) with flanking 5’ NdeI and 3’ NotI restriction endonuclease sites (GenScript), yielding pBS-Bbdcas9 ...
-
bioRxiv - Biochemistry 2024Quote: ... 500 bp upstream and downstream of the coxM C-terminus were fused to a twin-Strep II tag (5’GGCGGTTCGGGCTGGTCCCACCCCCAGTTCGAAAAGGGTGGGGGCTCCGGTGGCGGGTCGGGTGGGTCC GCCTGGTCGCACCCGCAGTTCGAGAAG 3’) in a 1111 bp fragment synthesised by Genscript. Two ∼500bp fragments upstream and downstream of the coxG gene were fused to create a deletion construct of 1011 bp and synthesised by Genscript ...
-
bioRxiv - Biochemistry 2024Quote: ... Recombinant cDNA encoding amino acids 1-338 of B*73:01 and B*46:01 with an N-terminal 3X FLAG-tag were manufactured by Genscript (Piscataway, NJ). Site-directed mutagenesis was performed with the QuikChange Kit (Stratagene) ...