Labshake search
Citations for Agilent :
1 - 50 of 4443 citations for 1 3 Nitro 10 11 dihydro 5H dibenzo b f azepin 5 yl ethanone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Mobile phase B consisted of acetonitrile:water 9:1 with 10 mM ammonium acetate + 5 μM medronic acid (Agilent), pH 9 ...
-
bioRxiv - Biochemistry 2022Quote: ... Sample from each PNT3 variant at 5 mg mL-1 in buffer B containing 6M GDN was injected onto an AdvanceBio SEC 2.7 µm (Agilent) SEC column ...
-
bioRxiv - Neuroscience 2024Quote: ... Data were analyzed using Masshunter Qualitative Analysis 10 and Masshunter Quantitative Analysis 11 (Agilent Technologies). Metabolite levels from different treatments were normalized to cell numbers.
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Developmental Biology 2024Quote: ... By site-directed mutagenesis the V5 tag of the pMT-Bip V5-His A vector was replaced by a Myc sequence (EQKLISEEDL) using the primers: Fw: 5’– AGCGAAGAGGATCTGACGCGTACCGGTCATCAT–3 and 5’– AATCAGTTTCTGTTCGAATTCCACCACACTGGACTAGTAGGTACC–3’ and the PFU ultra (Agilent). The cDNA for Drospondin without the signal peptide sequence and the stop codon was amplified using the clone GH02025 from Drosophila Genome Resource Center (DGRC) ...
-
bioRxiv - Immunology 2020Quote: ... anti-granzyme B (GrB-7; 1:50; Dako) and anti-PanCK (AE1/AE3 ...
-
bioRxiv - Microbiology 2024Quote: ... Sample DNA were serially diluted 1:10 in sterile nuclease-free water to dilute the concentration of any PCR inhibitors using a liquid handler (Agilent, Agilent Velocity 11 Vprep). 16S rRNA concentrations from embryonic tissue are reported from undiluted DNA as its concentration was approaching the limit of detection in diluted reactions ...
-
bioRxiv - Immunology 2021Quote: ... pH 10) and buffer B (10 mM ammonium formate, 90% ACN, 10% H2O, pH 10) using an Agilent 1200 HPLC (Agilent Technologies, Santa Clara, USA). In total ...
-
bioRxiv - Microbiology 2022Quote: ... Data analysis was performed using MassHunter Quant software (version B.10, Agilent Technologies) and confirmed by comparison with standards ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-CA125 epitope group B (Agilent, M11, 1:100), or anti-CA125 epitope group B (Fitzgerald ...
-
bioRxiv - Biochemistry 2020Quote: ... were separated by a gradient elution from 5% solvent B to 95% solvent B over 15 min on a high-capacity nano-LC chip (Agilent Technologies; part no. G4240-62010) driven by a 1200 series nano-flow HPLC system (Agilent ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Bioengineering 2024Quote: ... B: ACN with 0.1% TFA) on a Zorbax C18-300SB 5 μm 9.4x250mm column (Agilent), and analyzed via LC/MS-TOF on an Agilent G6230B ...
-
bioRxiv - Microbiology 2022Quote: ... Data analysis was performed using MassHunter Quantitative Analysis software (version B.10, Agilent Technologies) and confirmed by comparison to authentic standards ...
-
bioRxiv - Synthetic Biology 2024Quote: Data analysis was performed using MassHunter Quantitative Analysis software (version B.10, Agilent Technologies) and confirmed by comparison to authentic standards ...
-
bioRxiv - Microbiology 2023Quote: ... Data analysis was performed using MassHunter Quantitative Analysis software (version B.10, Agilent Technologies) and confirmed by comparison to authentic standards ...
-
bioRxiv - Microbiology 2023Quote: ... Data analysis was performed using MassHunter Quantitative Analysis software (version B.10, Agilent Technologies) and confirmed by comparison to authentic standards ...
-
bioRxiv - Microbiology 2023Quote: ... Data analysis was performed using MassHunter Profinder Analysis software (version B.10, Agilent Technologies) and confirmed by comparison with authentic standards ...
-
bioRxiv - Microbiology 2024Quote: ... Data analysis was performed using MassHunter Quantitative Analysis software (version B.10, Agilent Technologies) and confirmed by comparison to authentic standards ...
-
bioRxiv - Microbiology 2024Quote: ... Data analysis was performed using MassHunter Quantitative Analysis software (version B.10, Agilent Technologies) and confirmed by comparison to authentic standards ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... F.01.03.2357 (Agilent Technologies) for Windows was used for data analysis ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Microbiology 2023Quote: ... rabbit F(ab’)2 anti-human C1q-FITC (both at 5 µg/ml, Dako as described in (9)) ...
-
bioRxiv - Cell Biology 2024Quote: ... at 1:500 and 3-3’-diamino-benzidine-tetrahydrochloride (Dako, K3468). Stained sections were imaged using an NanoZoomer 2.0HT (Hamamatsu).
-
bioRxiv - Cell Biology 2021Quote: RNAi-resistant EGFP-ORP5A and EGFP-ORP5B were generated by introducing 4 silent point mutations in the region targeted by the 2 siRNA oligos (#10 and #11) by site-directed mutagenesis (Quickchange II-XL, Stratagene) and the following primers:
-
bioRxiv - Cancer Biology 2022Quote: ... version: F.01.03.2357 (Agilent Technologies). Metabolite counts were normalized using gamma-hydroxybutyrate.
-
bioRxiv - Molecular Biology 2022Quote: 3*10^3 of HPLFs per well were seeded into Seahorse XFe96 well plate (Agilent Technologies, 200941) for overnight ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were washed 3 times (5 min) in TBST prior to addition of secondary antibody (goat anti-rabbit HRP 1:10,000; Dako - P00448). Blots were washed 3 times in TBST prior to development using SuperSignal West Pico Plus substrate (ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: Culture supernatant data analyses were performed using MassHunter Quantitative Analysis software (version B.10, Agilent Technologies). Metabolite identifications were confirmed by matching to authentic standard spectra and retention time and spectra in the NIST Tandem Mass Spectral Library Version 2.3 (see Supplementary Tables 12 & 13 for background and validation methods of each metabolite) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Accuscript reverse transcriptase (6×10−5) (Agilent, product literature), and Phusion DNA polymerase after 20 cycles of amplification (1.2×10−5 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Cancer Biology 2020Quote: ... and B lymphocytes (anti-CD20 mouse IgG2a, 1:150, clone L26, Dako). Tumor epithelial cells were detected using anti-pan-cytokeratin Alexa 488-conjugated mouse IgG1 (1:100 ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... F.01.03.2357 (Agilent Technologies, Waldbronn, Germany) for windows was used for data acquisition ...
-
bioRxiv - Molecular Biology 2022Quote: ... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
bioRxiv - Cancer Biology 2020Quote: ... 11 μl of 10X GE Blocking agent (Agilent, Germany), 4 μl of 25% (v/v ...
-
bioRxiv - Microbiology 2024Quote: ... Sample DNA were serially diluted 1:10 in sterile nuclease-free water to dilute the concentration of any PCR inhibitors using a liquid handler (Agilent, Agilent Velocity 11 Vprep). 16S rRNA concentrations from embryonic tissue are reported from undiluted DNA as its concentration was approaching the limit of detection in diluted reactions ...
-
bioRxiv - Plant Biology 2021Quote: ... together with mass and retention time alignment (0.1 min and 5 ppm respectively) were done in Profinder B.07 software (from Agilent Technologies). Annotation was done based on the ‘find-by-formula’ algorithm ...
-
bioRxiv - Cancer Biology 2024Quote: ... using a Bravo automated pipette liquid handler (Velocity 11/Agilent). Media from cell plates were aspirated using an ELX plate washer ...
-
bioRxiv - Bioengineering 2022Quote: ... B.08.00 (Agilent Technologies, USA). A patchoulol standard (18450 ...
-
bioRxiv - Immunology 2022Quote: ... b) c-KIT− (DAKO-MA512944) (Nagasawa et al. ...
-
bioRxiv - Bioengineering 2023Quote: ... B.08.00 (Agilent Technologies, USA). The National Institute of Standards and Technology (NIST ...
-
bioRxiv - Biochemistry 2024Quote: ... B.08.00 (Agilent Technologies, USA). Metabolites were identified by comparing mass spectra against the National Institute of Standards and Technology (NIST ...
-
bioRxiv - Bioengineering 2024Quote: ... B.08.00 (Agilent Technologies, USA), and metabolites were identified by comparing their mass spectra against the National Institute of Standards and Technology (NIST ...
-
bioRxiv - Cell Biology 2023Quote: ... washed 3×10 minutes with PBS again and mounted using glycergel (Dako, Cat.N.C0563). The imaging was performed with the use of ZEISS microscopes ...
-
bioRxiv - Genomics 2020Quote: ... Ki67 (rat, DAKO M7249, clone TEC-3, 1:100), Carbonic Anhydrase 2 (rabbit ...
-
bioRxiv - Cancer Biology 2024Quote: ... (3) CD8 (Cytotoxic T Cells, 1:400, M7103; Dako)–Opal 570 ...
-
bioRxiv - Genetics 2023Quote: ... Kallisto quant settings were adjusted to -b 5 -l 160 -s 20 - -single - -threads 4 based on fragment lengths determined by the Agilent 4200 TapeStation (Agilent Technologies, Inc.)
-
bioRxiv - Neuroscience 2021Quote: ... Lipids were resolved on a 3 150 mm XDB-C8 column (5 μM particle size) (Agilent) at flow rate 0.4 mL/min ...
-
bioRxiv - Molecular Biology 2020Quote: ... with a specific primer (5’-CCTACACGACGCTCTTCC-3’) using AffinityScript Multiple Temperature cDNA Synthesis Kit (Agilent Technologies). Then ...
-
bioRxiv - Cell Biology 2020Quote: ... MassHunter version B.06.00 (Agilent Technologies).