Labshake search
Citations for Bio-Rad :
1 - 50 of 6662 citations for 1 3 Nitro 10 11 dihydro 5H dibenzo b f azepin 5 yl ethanone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Membranes were washed three times with 1X PBS for 5 min and developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in alkaline phosphatase buffer (Bio-Rad).
-
bioRxiv - Microbiology 2020Quote: ... followed by ExtrAvidin alkaline phosphatase conjugate and alkaline phosphatase substrate: p-nitro blue tetrazolium chloride enhanced 5-bromo-4chloro-3-indolyl phosphate (Bio-Rad). The membranes with the transferred rgp120 were incubated with the HRP-conjugated V5 antibody (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... nitro (Bio-Rad) and Trans-blot Turbo Transfer System (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... were detected as dark spots after a 10-min reaction with 5-bromo-4-chloro-3-idolyl phosphate and nitro blue tetrazolium using an alkaline-phosphatase-conjugate substrate (Bio-Rad, CA, USA). SFUs were counted using the AID ELISpot Reader System (Autoimmun Diagnostika) ...
-
bioRxiv - Microbiology 2024Quote: ... with 5% B-mercaptoethanol (Bio-Rad) was then added to the cell lysates and subsequently heated at 95°C for 5min ...
-
bioRxiv - Neuroscience 2024Quote: ... CD68 (1:400, FA-11, BioRad), and NLRP3 (1:500 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and stained with antibodies to α-tubulin (YL 1/2; 1:1000, Bio-Rad) and centromeres (HCT-0100 ...
-
bioRxiv - Microbiology 2023Quote: ... 1 µL primer 556R (5’ CTTTACGCCCARTRAWTCCG 3’) at 10 µM and 10 µL SYBER® Green Master Mix (Bio-Rad, Veenendaal, The Netherlands). The DNA extraction estimated an average rRNA yield corresponding to 5×10^8 bacterial cells/mL.
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Biochemistry 2021Quote: ... and transferred to the nitro-cellulose membrane (Bio-Rad) by semi-dry transfer (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and transferred to the Nitro-Cellulose membrane (Bio-Rad) by semi-dry transfer (Bio-Rad) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and transferred to the Nitro-Cellulose membrane (Bio-Rad) by semi-dry transfer (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2022Quote: ... using 10 mM CAPS buffer (3-[cyclohexylamino]-1-propanesulfonic acid [pH 11]) in a Mini Trans-Blot Electrophoretic Transfer Cell tank (Bio-Rad) according to protocol provided by the manufacturer ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-IBA-1 antibody (0.4 μg/mL, FUJIFILM Wako) and rat anti-CD68 antibody (5 μg/mL, clone FA-11, Bio-Rad) was used ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Cancer Biology 2020Quote: ... qRT-PCR was performed with C-kit variant 1 forward primer 5’-CAACAAAGAGCAAATCCATCCC-3’ and reverse primer 5’-CATCACAATAATGCACATCATGCC-3’ with iQ SYBR Green supermix (BioRad, Hercules, CA, Cat No. 1708882). The PCR program was as follows ...
-
bioRxiv - Neuroscience 2021Quote: ... 10-11 g of compressed extra-thick blot filter paper (1703966, Bio-Rad), cut into 8 evenly sized rectangles ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Genetics 2022Quote: ... We washed the membrane 3× 5 minutes in TBS-T and 1× 5 minutes TBS before imaging (Bio-Rad ChemiDoc).
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Neuroscience 2024Quote: ... rat anti-mouse CD68 (Bio-Rad, MCA1957; clone FA-11, 1/200), rat anti-mouse CD138 (BD Biosciences ...
-
bioRxiv - Cell Biology 2022Quote: ... Ampholytes (BioLytes pH 3–10, BioRad, Germany) were added to a total volume of 350 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.2% ampholytes pH 3-10 (BioRad) and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad ...
-
bioRxiv - Synthetic Biology 2024Quote: The samples (1 µL) were subjected to SDS-PAGE and transferred to a nitro cellulose membrane (Bio-Rad Laboratories, CA, USA). The membrane was blocked using 3% skim milk in PBST (137 mM NaCl ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10-15 μg of protein samples and 3-5 μL of Precision Plus Protein Dual Color Standards (BIO-RAD, #1610374) were loaded in NuPAGE 4-12% Bis-Tris protein gels (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... We loaded 10 µL of proteins at 10 µM mixed in a 3:1 ratio with 4X Laemmli Buffer Sample (Biorad) provided with 10% DTT ...
-
bioRxiv - Microbiology 2024Quote: ... The hypervariable region V3–V4 of the bacterial 16S rRNA gene was amplified using the primers 338F (5’-ACTCCTACGGGAGGCAGCAG-3’)/ 806R (5’-GGACTACHVGGGTWTCTAAT-3’) by using a T100 Thermal Cycler PCR thermocycler (BIO-RAD, USA). The PCR reaction mixture (20 µL ...
-
bioRxiv - Immunology 2024Quote: ... or monoclonal rat anti mouse CD68 (1/500 Bio-Rad, clone FA-11) in 2.5% serum ...
-
bioRxiv - Immunology 2021Quote: ... pooled and subjected to two consecutive preparative isoelectric focusing (IEF) at pH 3-10 (first separation) and pH 5-7 (second separation) using a Rotofor Cell (Bio-Rad). The individual IEF fractions were harvested ...
-
bioRxiv - Pathology 2024Quote: ... non–linear 3-10 pH gradient (Bio-Rad), followed by SDS-PAGE separation on 8-16% polyacrylamide gradient midi gels (Criterion TGX gels ...
-
bioRxiv - Cell Biology 2021Quote: ... 2-3 μg of total protein were loaded onto 10% SDS-polyacrylamide (29:1 Bio-Rad) gels with 10 μM phostag reagent (FUJIFILM Wako Chemicals ...
-
bioRxiv - Microbiology 2024Quote: ... 10% glycerol) then boiled with 1/3 volume of 4x Laemmli sample buffer (Bio-Rad, 1610747) for 10 mins ...
-
bioRxiv - Immunology 2024Quote: ... cells were stimulated with 5 μg/ml anti-Igκ plus anti-Igλ F(ab’)2 antibodies (BioRad). After 5 min of data acquisition ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was diluted 1:5 (for caecum 1:1 or 1:10) and qPCR was performed on a CFX384 Touch™ (Bio-Rad) with iTaq Universal SYBR (Bio-Rad ...
-
bioRxiv - Genomics 2023Quote: ... 5′-CCCCCCATCTGATCTGTTTCAC-3′) by qPCR using SsoFast EvaGreen Supermix (BioRad), according to the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2020Quote: ... carried out in glass tubes filled with polyacrylamide gel using a mixture of ampholytes 3/10 and 5/8 (Bio-Rad, USA) overnight at 4 °C ...
-
bioRxiv - Biophysics 2024Quote: ... 0.2% (w/v) Bio-Lyte 3/10 Ampholyte (BioRad), 1% bromophenol blue) ...
-
bioRxiv - Bioengineering 2023Quote: ... This step was repeated for 3 times and the samples were concentration-matched at OD500nm = 10 and mixed 1:1 with 2x Laemmli buffer (Bio-Rad), containing SDS and 2-mercaptoethanol ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 1:100 or BD Pharmingen 564766, 1:500, CD31: abcam ab28364, 1:100, vimentin: abcam ab92547, 1:100, CD68 [FA-11]: Bio-Rad MCA1957 ...
-
bioRxiv - Neuroscience 2024Quote: ... clone FA-11 (#MCA1957, BioRad, Hercules, CA); mouse monoclonal anti-PV ...
-
bioRxiv - Plant Biology 2021Quote: ... membranes were washed 3 times 5 min with washing solution and incubated 1 h with anti-rabbit IgG HRP-conjugated secondary antibodies (Bio-Rad, 1:3000) at room temperature ...
-
bioRxiv - Pathology 2024Quote: ... plus 0.02% v/v pI 3–10 ampholytes (Bio-Rad). IEF was performed using 11 cm strips ...
-
bioRxiv - Biophysics 2024Quote: ... Immobilized pH gradient (IPG) (pH 3–10) strip (ReadyStrip, BioRad) was loaded with proteins dissolved in 125 μl of rehydration buffer and passively rehydrated overnight at 25 °C ...
-
bioRxiv - Genetics 2020Quote: ... in 11 parallel transformations (1 mL each) on a Bio-Rad MicroPulser (Bio-Rad, #165-2100). The parallel transformations were combined and mixed with a total of 9.5 mL of recovery medium ...
-
bioRxiv - Genetics 2021Quote: ... rat anti CD68 (1:200; clone FA-11/MCA1957, Bio-Rad Laboratories Inc, Hercules, CA, USA); rabbit anti LAMP1 (1:200 ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were washed with TBS-T (3 × 5 minutes) and incubated in horseradish peroxidase (HRP)-conjugated secondary antibody (1:1000) (BioRad) in blocking solution for 1 hour ...