Labshake search
Citations for Merck :
1 - 50 of 6086 citations for 1 3 Nitro 10 11 dihydro 5H dibenzo b f azepin 5 yl ethanone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... and untransfected cells were cultured for 2 weeks in a complete medium containing 3 μM N-[(1R,2R)-1- (2,3-dihydro-1,4-benzodioxin-6-yl)-1-hydroxy-3-pyrrolidin-1-ylpropan-2-yl]nonanamide (Genz-123346) (Merck, Darmstadt, Germany), a glucosylceramide synthase inhibitor [26].
-
bioRxiv - Cancer Biology 2020Quote: ... containing 3-nitro-L-tyrosine [5 µM] (Merck, Darmstadt, Germany) as internal standard (ISTD ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, 20 μl, 5 mg/ml, Merck) was added to each well ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-cathepsin B (Abcam, ab92955, 1:1,000 and Merck, Ab-3 1:100) and anti-β-actin mouse monoclonal antibody (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2022Quote: ... Anti-alpha tubulin (Merck-SIGMA, clone B-5-1-2) was used as a loading control at 1:10000.
-
bioRxiv - Neuroscience 2023Quote: ... the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA) assay was used to analyze the cell viability of SH-SY5Y cells ...
-
bioRxiv - Cancer Biology 2024Quote: The 3-(4,5-dimethylthiazo1-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Merck Sigma, Burlington, MA) reduction assay was used to quantify cell proliferation ...
-
bioRxiv - Molecular Biology 2024Quote: ... and anti-α-Tubulin (B-5-1-2, Merck Millipore/Sigma) antibodies were purchased ...
-
bioRxiv - Bioengineering 2021Quote: ... The LCLs were maintained under aseptic conditions in a 1:1 mixture of Dulbecco’s modified Eagle medium and nutrient mixture F-12 (DMEM/F12; DF-041-B; Merck Millipore) supplemented with 1% antibiotic/antifungal (15240062 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5% FBS (ES-009-B, Merck) was added to gelatin during coating for nPSCs (p20) ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse monoclonal anti-α-tubulin clone B-5-1-2 (Merck T5168; 1:5000), mouse monoclonal anti-EF-18 clone A-5 (Santa Cruz Biotechnology sc-393731 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 3-(3,5-dioxo-1,2,4-oxadiazolidin-2-yl)-L-alanine (quisqualate) was purchased from Merck (Darmstadt, Germany). AF647-conjugated 9E10 antibody was prepared in-house as described previously (Cook et al. ...
-
bioRxiv - Plant Biology 2024Quote: ... each probe (at a final concentration of 10 pM) was incubated in reaction buffer (5 mM CoCl2, 0.1 mM DIG-11-dUTP (Sigma Merck), 0.1 mM dATP ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... excess media was removed from wells and mf were incubated with 0.5 mg/ml MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (Merck) in PBS at 37°C for 90 min ...
-
bioRxiv - Cancer Biology 2021Quote: Cell proliferation was assessed by 3-(4,5-1,2methylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Merck Millipore). K562 cells (5,000/well ...
-
bioRxiv - Systems Biology 2022Quote: ... 70 kDa FITC-dextran and MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) were purchased from Merck Life Science UK Ltd. ...
-
bioRxiv - Cancer Biology 2024Quote: ... cell viability was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA) assay ...
-
bioRxiv - Molecular Biology 2024Quote: ... animals were transferred to 3 cm NGM agar plates containing 5-Fluorouracil (5-FU) (10 µM) (Merck, #F6627) to prevent progeny production ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Neuroscience 2020Quote: The cell viability was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA) assay ...
-
bioRxiv - Genomics 2021Quote: ... with A pestle ~10 times following B pestle ~20 times in lysis buffer [5 mM CaCl2 (Merck, A546282), 3 mM Mg(Ac)2 (Roth ...
-
bioRxiv - Biophysics 2023Quote: ... exposure was evaluated by a MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) test in a 96-well plate according to the manufacturer’s (Merck) protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... 200 μl of Protein powder solutions (1 mg/ml) were added to 3 cm NG plates with 10 µM 5-FU (Merck, #F6627). After the plates had dried ...
-
bioRxiv - Neuroscience 2021Quote: Viability of SH-SY5Y cells after treatments with or without H-LIPEF was assessed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA) assay ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Polymyxin B sulfate (Merck Millipore, 10 μg/mL), thymidine (Alfa Aesar ...
-
Comparative membrane proteomics reveals diverse cell regulators concentrated at the nuclear envelopebioRxiv - Cell Biology 2023Quote: ... supplemented with 10 μM Palmostatin B (Merck #17851) and Halt phosphatase and protease inhibitor cocktails (ThermoFisher #78440) ...
-
bioRxiv - Plant Biology 2020Quote: ... the strain was grown on solid King’s medium B (Pseudomonas agar F, Merck KGaA, 64271 Darmstadt, Germany) supplemented with 50 μg mL−1 rifampicin at 25°C in the dark for 3 days ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1% Amphotericin B (Merck, A2942) and 5 µg/ml Apo-Transferrine (Merck ...
-
bioRxiv - Cell Biology 2024Quote: ... MRS 2211 (2-[(2-chloro-5-nitrophenyl)azo]-5-hydroxy-6- methyl-3-[(phosphonooxy)methyl]-4-pyridinecarboxaldehyde disodium salt and MRS 2395 (2,2-dimethyl-propionic acid 3-(2-chloro-6-methylaminopurin-9- yl)-2-(2,2-dimethyl- propionyloxymethyl)-propyl ester) were obtained from Merck (Darmstadt, Germany).
-
bioRxiv - Biochemistry 2020Quote: ... 0.625 mM TBTA (Tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine) (Merck Millipore), and 6.25 mM CuSO4 (Merck Millipore) ...
-
bioRxiv - Immunology 2023Quote: ... Staphylococcus-Enterotoxin-B (SEB) (5 µg/ml, Merck Sigma-Aldrich), DAPI (Merck Sigma-Aldrich) ...
-
bioRxiv - Developmental Biology 2023Quote: ... supplemented with 10% FBS final (Merck, #ES-009-B). After washing twice with DPBS (Gibco ...
-
bioRxiv - Immunology 2023Quote: ... peptides were dissolved at a concentration of 1 to 5 mg ml-1 in 1x PBS and incubated with TCEP agarose CL4-B (Merck) for 1 hour to reduce paired cysteines ...
-
bioRxiv - Neuroscience 2021Quote: RNAs with sequences 5’-AAGGAUGGAUGGAG-3’ (healthy) and 5’-AAGCAUGGAUGGAG-3’ (risk) were synthesised by Merck, resuspended in Ultrapure water ...
-
bioRxiv - Neuroscience 2023Quote: The viability of SH-SY5Y cells after indicated treatments was evaluated using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) assay ...
-
bioRxiv - Biophysics 2023Quote: ... Liposomes were labeled before experiments with 1% of 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-(lissamine rhodamine B sulfonyl) (PE-Rhodamine) (Merck) at a concentration of 10µg/mL.
-
bioRxiv - Cancer Biology 2024Quote: ... and 1% Amphotericin B (Merck, A2942). BMMSCs were defined by adherence to culture flasks and myeloma cells remained in suspension or were lightly adherent to the BMMSCs ...
-
bioRxiv - Plant Biology 2020Quote: ... The strains were routinely grown on solid King’s Medium B (KMB; Pseudomonas agar F, Merck KGaA, 64271 Darmstadt, Germany) supplemented with rifampicin 100 μg/mL at 24°C for 4 days ...
-
bioRxiv - Cell Biology 2023Quote: ... for 10 min and with 0.1% Sudan black B (Merck) in 70% ethanol for 20 min to quench the autofluorescence of immune cells ...
-
bioRxiv - Cell Biology 2021Quote: ... These Cas9-podocytes were transfected twice with two sgRNA targeting MATN2 (5’-GTCACGATCATTATGACCCG-3’; 5’-CTTGACCTTTGCATAGTCAT-3’; Merck) using RNAiMAX (Thermofisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... After 11 days cells were fixed with 1% formaldehyde (Merck, F8775) for 15 min at room temperature with gentle rocking ...
-
bioRxiv - Immunology 2024Quote: ... Ac-YVAD-cmk Caspase 1/11 inhibitory peptide (Merck; 100 µM) and Pepinh-MYD MyD88 inhibitory peptide (Invivogen ...
-
bioRxiv - Cell Biology 2022Quote: ... 1% 250 μg/ml Amphotericin B (Merck), and 1% 100 units/ml penicillin (Merck) ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 % penicillin/streptomycin/amphotericin B (#A5955, Merck), 0.1 % hydrocortisone (#H0888 ...
-
bioRxiv - Neuroscience 2024Quote: ... and B-actin (Merck, A5316, 1:5000) overnight at 4 °C ...
-
bioRxiv - Plant Biology 2024Quote: ... The extracts were spotted on a 5 cm x 5 cm TLC Silica gel 60 F₂₅₄ plate (Merck, Darmstadt, Germany). The blots were stained by spraying with a methanolic solution including 1% diphenylboric acid 2- aminoethylester (DPBA ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Microbiology 2024Quote: ... The faecal slurries were aliquoted into tubes and 250 nM of ATTO 488-tagged Mission MicroRNA mimics (Sequence: 5’-[ATTO488]UCAACAUCAGUCUGAUAAGUCUA [dT][dT]-3’) and miR-21scr (Sequence: 5’-[ATTO488]AUCUUAUAACGACCGAAUAUUGC[dT][dT]-3’; both from Merck) were added ...
-
bioRxiv - Developmental Biology 2024Quote: ... germanica adults using an antisense LNA (locked nucleic acid) probe conjugated to Digoxigenin (DIG) at the 5’ and 3’ ends (5’-DIG-GGAGGTCCCCCAGACCGGCACAGACCGAA-DIG-3’, Merck). Ovaries were dissected under Ringer’s saline ...