Labshake search
Citations for Eppendorf :
1 - 50 of 1002 citations for 1 3 Nitro 10 11 dihydro 5H dibenzo b f azepin 5 yl ethanone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Multidrug resistance plasmids commonly reprogramme expression of metabolic genes in Escherichia colibioRxiv - Microbiology 2023Quote: ... The 5 ml overnight culture was centrifuged at 8,000 rpm (Eppendorf MiniSpin F-45-12-11) for three minutes ...
-
bioRxiv - Microbiology 2023Quote: ... A 1 mL sample was centrifuged for five minutes at 10,000 rpm (Eppendorf MiniSpin F-45-12-11), resuspended in 1 mL phosphate buffered saline (PBS ...
-
Multidrug resistance plasmids commonly reprogramme expression of metabolic genes in Escherichia colibioRxiv - Microbiology 2023Quote: ... A 1 ml sample of overnight suspension was centrifuged for five minutes at 8,000 rpm (Eppendorf MiniSpin F-45-12-11), the pellet resuspended in 1 ml PBS ...
-
Multidrug resistance plasmids commonly reprogramme expression of metabolic genes in Escherichia colibioRxiv - Microbiology 2023Quote: ... Transconjugant cultures were then centrifuged for five minutes at 10,000 rpm (Eppendorf MiniSpin F-45-12-11), resuspended in 1 ml PBS ...
-
bioRxiv - Immunology 2022Quote: ... The mixture was incubated for 5h at 31°C on a thermoblock (Eppendorf), followed by the removal of 2-MEA by buffer-exchanging to PBS using 100kDa Vivaspin6 columns (Sartorius ...
-
Multidrug resistance plasmids commonly reprogramme expression of metabolic genes in Escherichia colibioRxiv - Microbiology 2023Quote: ... A 1.5 ml sample was centrifuged for five minutes at 8,000 rpm (Eppendorf MiniSpin F-45-12-11), resuspended in 1 ml phosphate buffered saline (PBS) ...
-
bioRxiv - Biochemistry 2024Quote: ... 10 min (Eppendorf centrifuge #5418, rotor FA-45-18-11).
-
bioRxiv - Microbiology 2021Quote: ... and centrifuged for 3 min at 13806 rpm (Centrifuge 5424, FA-45-24-11, Eppendorf) before use ...
-
bioRxiv - Cell Biology 2024Quote: ... a mix of pre-polymerized mother filaments (formed from 1 μM 10 % AlexaFluor-568-labeled G-actin incubated in F-buffer in an Eppendorf tube for 2 hours ...
-
bioRxiv - Biochemistry 2021Quote: ... diluted 1:1 with F-actin buffer and cleared by centrifugation (Eppendorf centrifuge 5424R ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 times for 5 seconds each to ensure homogenization and centrifuged at 14000 x g for 10 minutes at 4° C (Eppendorf centrifuge 5424 R, FA-45-24-11 rotor). Supernatant was precleared by rotating 20 µl Protein A agarose beads (Cell Signaling #9863 ...
-
bioRxiv - Microbiology 2021Quote: ... All centrifugation steps were performed at 13806 rpm for 5 min (Centrifuge 5424, FA-45-24-11, Eppendorf). Recombinant E ...
-
bioRxiv - Microbiology 2021Quote: ... 0.5-1 mL culture sample was harvested by centrifugation for 3 min at 13806 rpm (Centrifuge 5424, FA-45-24-11, Eppendorf) and resuspended in 100-500 µL 10 mM NaOH depending on the size of the cell pellet ...
-
bioRxiv - Genetics 2021Quote: ... 000 rpm for 10 min at 4°C (Eppendorf 5424R with rotor Eppendorf FA-45-24-11). The supernatant was mixed with Laemmli Buffer containing β-mercaptoethanol and heated at 95°C for 10 min ...
-
bioRxiv - Genetics 2021Quote: ... 000 rpm for 10 min at 4°C (Eppendorf 5424R with rotor Eppendorf FA-45-24-11). The supernatant was mixed with Laemmli Buffer containing β-mercaptoethanol and heated at 95°C for 10 min ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were maintained in a humidified atmosphere of 5% CO2 and 37 °C and were passaged every 2-3 days into 10 cm polystyrene coated plates (Eppendorf; EP0030700112-300EA) upon reaching high density ...
-
Malaria parasite HOPS/CORVET complexes are critical for endocytosis and invasion organelles functionbioRxiv - Cell Biology 2024Quote: ... 200 mM hypoxanthine and 2-5% fresh human RBCs (B+; provided by Universität Klinikum Eppendorf, Hamburg). Cultures were maintained at 37 °C ...
-
bioRxiv - Bioengineering 2020Quote: ... were centrifuged at 16,873 gav for 3 min in the FA-45-18-11 fixed angle (45°) rotor of an Eppendorf model 5418 centrifuge (Eppendorf AG, Hamburg, Germany). The pellets were resuspended in 1 mL of 2.5% (v/v ...
-
bioRxiv - Microbiology 2024Quote: ... Aqueous phage was separated by centrifugation (14,000 rpm for 10 minutes at room temperature in 5418 R Centrifuge equipped with FA-45-18-11 rotor (Eppendorf)) ...
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Physiology 2024Quote: ... plasma samples were thawed from storage at -80°C and centrifuged (5,000 x g, 10 minutes, 4 °C; Eppendorf 5427R with rotor FA-45-48-11; Eppendorf, Enfield, CT). Supernatants were transferred to 96-well plates and stored at -80°C until analysis ...
-
bioRxiv - Biophysics 2021Quote: ... The bicelle mixture (~1 mL) was centrifuged (13,400 rpm, Eppendorf F45-12-11 rotor, 4°C, 30 sec) to remove insoluble debris and the supernatant concentrated to ~200 μL using a 0.5 mL 10 kDa MWCO centrifugal filter (Amicon ...
-
bioRxiv - Bioengineering 2023Quote: ... in LB (10 g Tryptone, 5 g Yeast Extract, 10 g NaCl) grown in a 10 L BioFlo 320 Fermenter (Eppendorf). At inoculation ...
-
bioRxiv - Developmental Biology 2023Quote: ... were mixed in HEPES-CZB medium containing 5 μg/ml cytochalasin B (CB) and injected into the cytoplasm of fertilized eggs using a FemtoJet microinjector (Eppendorf) with constant flow settings ...
-
bioRxiv - Developmental Biology 2024Quote: ... were mixed in HEPES-CZB medium containing 5 μg/ml cytochalasin B (CB) and injected into the cytoplasm of fertilized eggs using a FemtoJet microinjector (Eppendorf) with constant flow settings ...
-
bioRxiv - Microbiology 2023Quote: ... culture samples (10 ml) were centrifuged at 5000 rpm in a F-34-6-38 rotor in a 5804R centrifuge (Eppendorf AG) for 10 min at room temperature ...
-
bioRxiv - Biochemistry 2024Quote: ... Proteins were pelleted by centrifugation at 15.000 x g (10 min, 4°C in cold cabinet, Eppendorf centrifuge #5418, rotor FA-45-18-11). After allowing the pellet to air dry ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The fractions with highest concentrations (200–400 μg mL−1) were stored as 5–10 μL aliquots in Protein LoBind tubes (Eppendorf) at –80 °C.
-
bioRxiv - Biophysics 2020Quote: ... and centrifuged at 13,000 rpm (rotor #,FA-45-30-11, Eppendorf) for 45 minutes at 20°C to remove small aggregates and particulate matter.
-
bioRxiv - Biochemistry 2023Quote: ... previously spun down (Eppendorf 5427R, FA-45-30-11, 18000g, 10min), was manually injected onto a Superdex 200 increase 5/150 GL column (GE Healthcare) ...
-
bioRxiv - Cell Biology 2024Quote: Centrifuge (Eppendorf, model no.5424R; rotor no. FA-45-24-11)
-
bioRxiv - Neuroscience 2020Quote: ... Microinjection of 300 nl was made over 3 min using a Femtojet injector (~5 psi, Eppendorf), and the exposed cortical surface was covered by a sterilized round cover glass (3 or 4 mm in diameter ...
-
bioRxiv - Plant Biology 2020Quote: ... Bacterial pellets obtained from 1 mL of cell culture centrifuged at 13,000 rpm (Eppendorf 5424 Centrifuge with Fa-45-11 Rotor) were thoroughly washed three times with 1 mL fresh LB medium to remove residual antibiotics and were re-suspended in 100 µL liquid LB medium ...
-
bioRxiv - Molecular Biology 2022Quote: ... for 20 minutes (Eppendorf centrifuge 5424 R, Rotor FA-45-24-11). A portion of each lysate (60-100 µL ...
-
bioRxiv - Microbiology 2021Quote: ... centrifuged at 11 000 rpm for 20 min (5430R, Eppendorf, Hamburg, Germany) to pellet cells ...
-
bioRxiv - Neuroscience 2024Quote: ... regionalized neural organoids (1-3 organoids per one Eppendorf tube) were transferred into a 1.5 mL Eppendorf tube containing 200 μL of the neural medium ...
-
bioRxiv - Microbiology 2024Quote: ... via centrifugation (5-10 min, 3220 rcf, 4°C, Centrifuge 5810 R; Eppendorf). Then the pellet was resuspended thoroughly in ice-cold 1xPBS and fixed by 1:1 dilution in ice-cold absolute ethanol ...
-
bioRxiv - Neuroscience 2024Quote: ... and centrifuged at 1000g in swinging buckets (Eppendorf, Rotor S-24-11-AT) at 4°C for 10 minutes.
-
bioRxiv - Microbiology 2021Quote: ... The supernatant was syringe filtered into an HPLC vial (Eppendorf FA-45-24-11) using a 0.22 μm PVDF filter ...
-
bioRxiv - Plant Biology 2023Quote: ... Bound phosphopeptides were then eluted 3 times with 100 µL ammonium hydroxide (5% v/v) into 1.5mL Lo-Bind tubes (Eppendorf). These were then frozen and lyophilized ...
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-P2X4 (kind gift of F. Nolte (Universitätsklinikum Hamburg-Eppendorf)) ...
-
bioRxiv - Cell Biology 2021Quote: ... were vortexed 3 min at room temperature followed by centrifugation at 4,500 x g for 5 min at 4°C (Eppendorf #5010R). The supernatant fluid was poured into a chilled 2 ml screw-capped tube ...
-
bioRxiv - Cell Biology 2024Quote: ... then mixed at 950 rpm for 5 min at 10 °C in an Eppendorf Thermomixer (Eppendorf South Pacific Pty Ltd. ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 µM AQT0615) and 10 µL were added in each well with a multichannel pipette (Eppendorf). The 0 % control wells were filled with 10 µL of pure reaction buffer ...
-
bioRxiv - Developmental Biology 2024Quote: ... Another 1 ml of Washing buffer B was added and transferred to 1.5 ml Protein lo-bind tubes (Eppendorf, 0030108116) with beads ...
-
bioRxiv - Physiology 2020Quote: ... 1% Antibiotic-Antimycotic] in a 5% CO2 incubator (Galaxy 170R, Eppendorf) at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... All the 11 samples related to each batch were pooled and dried in SpeedVac (Eppendorf EP022822993) before desalting with Sep-Pak® Plus C18 cartridges ...
-
bioRxiv - Genetics 2024Quote: ... Femora were centrifuged for 10min at 13,200rpm (Eppendorf® 5702 Centrifuge with F45-24-11 rotor) to remove marrow ...
-
bioRxiv - Cell Biology 2024Quote: ... 4℃ for 20 min using Eppendorf 5810R Centrifuge with FA-45-30-11 Rotor (Eppendorf, Germany), respectively ...