Labshake search
Citations for GenScript :
201 - 250 of 6194 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... HA) (E1), HPV16 E2, pGL3 Basic, pGL3 Control, ptk6E2 (22, 68, 69) E2-K mutant plasmids were generated by GenScript.
-
bioRxiv - Molecular Biology 2024Quote: ... and were sequence verified (Genscript Piscataway). Details of standard virus production pipelines can be found at the Broad Institute’s Genetic Perturbation Platform website (https://portals.broadinstitute.org/gpp/public/) ...
-
bioRxiv - Immunology 2024Quote: ... the Thosea assigna virus (TAV) 2A protease and the mature IGIP was generated with a cloning spacer downstream and acquired from Genscript (Piscataway, NJ). The fragment was digested with AarI (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by affinity purification of sera over columns containing the immobilized peptide (Genscript). All antibodies used for IP and WB are listed in Supplementary Table 13.
-
bioRxiv - Molecular Biology 2024Quote: ... ancX-16 were codon optimized for Saccharomyces cerevisiae and synthesis by Genscript, China ...
-
bioRxiv - Immunology 2024Quote: ... The biotin-K417N peptide (VRQIAPGQTGNIADYNYKLP ; GenScript) was mixed with the streptavidin-AF647 in a 4:1 ratio at room temperature for 2 hours ...
-
bioRxiv - Physiology 2024Quote: ... following heterologous expression in a proprietary TurboCHO™ expression system (Genscript, Piscataway, NJ). To produce C-terminally amidated recombinant ITPa (ITP-PE) ...
-
bioRxiv - Physiology 2024Quote: ... recombinant ITPa was independently produced by Genscript (Genscript, Piscataway, NJ) following heterologous expression in a proprietary TurboCHO™ expression system (Genscript ...
-
bioRxiv - Physiology 2024Quote: ... recombinant ITPa was independently produced by Genscript (Genscript, Piscataway, NJ) following heterologous expression in a proprietary TurboCHO™ expression system (Genscript ...
-
bioRxiv - Neuroscience 2024Quote: ... The sequence was created using the tool at https://worm.mpi-cbg.de/codons/cgi-bin/optimize.py and synthesized by GenScript. Then GCaMP8f was subcloned into an expression vector (derived from pRL231 ...
-
bioRxiv - Plant Biology 2024Quote: ... Primary antibodies used included anti-myc (A00704, GenScript), anti-RFP (YH80520 ...
-
bioRxiv - Neuroscience 2024Quote: ... The mouse Tmem63b gene (NM_198167) was synthesized by GenScript.
-
bioRxiv - Molecular Biology 2024Quote: ... Vectors encoding either intron 2 retained PSMB8 (i2R-PSMB8) or the canonical full-length transcript (FL-PSMB8) in pcDNA3.1 were obtained from GenScript, outgrown in DH5α E ...
-
bioRxiv - Molecular Biology 2024Quote: ... and synthesised by GenScript. All plasmids used in this study are available from Addgene.
-
bioRxiv - Immunology 2024Quote: ... The synthesized genes were subcloned into a SFG88 retroviral vector and the identity of the new sequences was confirmed by Sanger sequencing (Genscript). Similarly ...
-
bioRxiv - Immunology 2024Quote: ... tEGFR and ΔFAS sequences were separated by P2A motifs and synthesized by Genscript. The synthesized genes were subcloned into a SFG88 retroviral vector and the identity of the new sequences was confirmed by Sanger sequencing (Genscript) ...
-
bioRxiv - Immunology 2024Quote: ... NLS-mCherry and NLS-GFP sequences were synthesized and cloned into an SFG vector by Genscript. For transfection of the plasmids mentioned above ...
-
bioRxiv - Molecular Biology 2024Quote: Polyclonal rabbit antibodies against phopsho-TRF1 and TRF2 were generated by Genscript. Briefly ...
-
bioRxiv - Immunology 2024Quote: ... 50 ng/mL of IL-2 (Z02764, GenScript), 10 ng/mL of IL-4 (HY-P70653 ...
-
bioRxiv - Plant Biology 2024Quote: ... coli followed by protein purification using Glutathione Resin (GenScript, Cat. No. L00206). About 80μg cleaved NFR5 was collected for analysis ...
-
bioRxiv - Neuroscience 2024Quote: ... coli (Genscript, Piscataway, NJ). This C-terminal sequence is unrelated to the C-termini of Kv2.1 and Kv2.2 and is also highly divergent between KvS family members ...
-
bioRxiv - Neuroscience 2024Quote: ... and a plasmid encoding human Kv5.1 with a C-terminal GFP tag was generated by Genscript. The Kv5.1BBS construct was generated at Genscript by inserting a bungarotoxin-binding site (GGWRYYESSLLPYPDGG ...
-
bioRxiv - Neuroscience 2024Quote: ... UAS-KCR1-GS and UAS-WiChR transgenic lines were generated by de novo synthesis (Genscript) of Drosophila codon-optimized HcKCR insert sequences 43 (Genbank #MZ826861 and #MZ826862 ...
-
bioRxiv - Neuroscience 2024Quote: ... ACR and KCR construct variants were cloned into the multiple cloning site of a pcDNA3.4 vector (Genscript) by XhoI and EcoRV restriction enzyme digest ...
-
bioRxiv - Neuroscience 2024Quote: ... After Sanger sequencing verification (Genscript), the fragments were cloned into an pJFRC7-20XUAS-IVS-mCD8::GFP vector (Addgene plasmid # 26220) ...
-
bioRxiv - Neuroscience 2024Quote: ... An additional plasmid encoding green fluorescent protein (GFP; pCAG-GFP; GenScript), was used to label successfully transfected cells ...
-
bioRxiv - Neuroscience 2024Quote: ... 8 µg of protein was loaded onto a 10% SurePAGE polyacrylamide gel (Genscript) and resolved for 1 cm ...
-
bioRxiv - Microbiology 2024Quote: ... lentiviruses were generated in HEK293T cells by transfection of pLentiCRISPRv2 -Puro plasmid containing a single guide RNA (sgRNA) (GTACTGTAGATGGTGCTCAT) (GenScript) targeting ACE2 ...
-
bioRxiv - Neuroscience 2024Quote: ... and supernatant was loaded to anti-Flag M2 affinity resin (GenScript), washed in buffer containing 25 mM HEPES pH 7.4 ...
-
bioRxiv - Molecular Biology 2024Quote: ... (2021),synthesized by GenScript (GenScript, New Jersey ...
-
bioRxiv - Molecular Biology 2024Quote: ... (2021),synthesized by GenScript (GenScript ...
-
bioRxiv - Molecular Biology 2024Quote: ... Other pAAV-related plasmids were developed by modifying these plasmids using standard molecular biology techniques and the GenBuilder Cloning kit (GenScript). PCR primers and oligonucleotides used were obtained from Integrated DNA Technologies (IDT) ...
-
bioRxiv - Microbiology 2024Quote: ... The remaining systems were generated by and obtained from GenScript Biotech Corporation (EU Headquarters) ...
-
bioRxiv - Cell Biology 2024Quote: ... and eluted from the column by incubation with either reduced glutathione (to retain the GST tag) or with 10 units Prescission Protease (Genscript) to obtain protein without a tag ...
-
bioRxiv - Neuroscience 2024Quote: ... a toxin Eraser endotoxin removal kit (#L00338, Genscript) with a high efficiency endotoxin removal resin was employed ...
-
bioRxiv - Bioengineering 2024Quote: pET17b-OVA-ZE plasmid was purchased from Genscript. E ...
-
bioRxiv - Neuroscience 2024Quote: ... New constructs were commercially synthesized and subcloned into either the pCA LNL or pCig2 plasmid backbones by GenScript (Piscataway, NJ). Subsequent exchange of expression vectors between pCig2 and pCA LNL and other subcloning were performed in house using standard procedures ...
-
bioRxiv - Neuroscience 2024Quote: ... as determined by mass spectrometry and HPLC (GenScript Corp, Piscataway, NJ).
-
bioRxiv - Neuroscience 2024Quote: All the peptides were synthesized by GenScript and purified to ≥98% ...
-
bioRxiv - Molecular Biology 2024Quote: ... cerevisiae and subcloned between PGK1 promoter and CYC1 terminator of Y22-PE by Genscript, China.
-
bioRxiv - Microbiology 2024Quote: ... The novel oriTs and relaxase operons were synthesized de novo and cloned into pCOLADuetTM-1 by GenScript USA Inc ...
-
bioRxiv - Neuroscience 2024Quote: ... The mCherry WT- dynamin-2 was constructed by GenScript Corporation (Nanjing ...
-
bioRxiv - Neuroscience 2024Quote: ... and all plasmids were manufactured by Genscript (Piscataway, NJ). Plasmid DNA was expanded and isolated using a QIAGEN Plasmid Maxi Kit (Germantown ...
-
bioRxiv - Cell Biology 2024Quote: ... Drosophila Genetic Research Center) with a synthetic DNA sequence corresponding to the missing 5’ sequence (GenScript). The cDNA corresponding to the mCherry sequence was ligated to the 3’ end of the rdgC cDNA after the removal of the stop codon ...
-
bioRxiv - Cell Biology 2024Quote: ... The PLCε-FLAG-P2A-mCherry plasmid was synthesized and subsequently cloned into a pCMV-script EX vector by GenScript. For rescue experiments involving PLCε KO chromaffin cells ...
-
bioRxiv - Cell Biology 2024Quote: ... Peptides encoding residues 166–181 of human CHMP6 or various truncations of HCMV pUL71 were purchased from Genscript at >95% purity and the dry peptides were resuspended in ITC buffer to the desired concentration ...
-
bioRxiv - Cell Biology 2024Quote: ... (Biotin-GRMTNGAMNVEIGNPTYKMYEGGEPDDG) and LRP1 (NPXA) (Biotin-GRMTNGAMNVEIGNPTAKMYEGGEPDDG) peptides corresponding to human LRP1 amino acid residues 4458-4483 were purchased from GenScript and ...
-
bioRxiv - Cell Biology 2024Quote: The human K6a sequence flanked by an amino-terminal HA tag and a carboxyl-terminal Flag tag (HA-hK6a-FLAG) was generated by PCR using pUC57-hK6a as a template which is codon-optimized for mammalian cell expression (Genscript). The sequence was inserted into lentiviral expression vector pCDH533-IRES-Neo (System Biosciences ...
-
bioRxiv - Cell Biology 2024Quote: ... PPTC7-1_pLentiCRISPR V2 and PPTC7-2_pLentiCRISPR V2 plasmids were generated by Genscript® based on the the following gRNA sequences ...
-
bioRxiv - Cell Biology 2024Quote: ... The supernatant was mixed with 5×sample buffer (MB01015, GenScript), heated to 100°C for 8-10 minutes ...