Labshake search
Citations for GenScript :
201 - 250 of 5821 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... The mCherry WT- dynamin-2 was constructed by GenScript Corporation (Nanjing ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by affinity purification of sera over columns containing the immobilized peptide (Genscript). All antibodies used for IP and WB are listed in Supplementary Table 13.
-
bioRxiv - Molecular Biology 2024Quote: ... One membrane was incubated with the anti-transthyretin antibody (1:1,000; Genscript) in 5 % milk overnight ...
-
bioRxiv - Molecular Biology 2024Quote: ... with the following modifications: the membranes were incubated overnight with either a primary anti-transthyretin antibody (1:1,000; Genscript) or 5 µM TAD1.
-
bioRxiv - Genetics 2024Quote: ... the Schneider’s medium was replaced by Schneider’s medium containing 100 ng/mL of different synthesized Drosophila neuropeptides (Genscript, the sequences of the peptides are shown in Supplementary Table 2) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Synthesis of these fragments and their insertion into the pUC19 backbone were accomplished through gene synthesis services provided by Genscript. Construct_1 vector incorporated the Gluc T4PIE EMCV sequence ...
-
Srs2 binding to PCNA and its sumoylation contribute to RPA antagonism during the DNA damage responsebioRxiv - Molecular Biology 2024Quote: Cells from log-phase cultures were treated with 5 μg/mL α factor (GenScript RP01002) for 1 h ...
-
bioRxiv - Neuroscience 2024Quote: ... GO grids were first incubated with 3 µL of 250 nM recombinant protein G (Genscript Z02007) in resuspension buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... The samples were loaded onto three independent SurePAGE Bis-Tris 10x8 4-12% gels (Genscript M00652) and run at 150 V for approximately one hour ...
-
bioRxiv - Molecular Biology 2024Quote: ... All constructs were synthesized by GenScript Biotech (NJ ...
-
bioRxiv - Molecular Biology 2024Quote: ... coli codon-optimized 10xHis- PPEP-4 (lacking the signal peptide) construct was ordered from GenScript. The pET-16b 10xHis-PPEP-4 plasmid was transformed to E ...
-
bioRxiv - Molecular Biology 2024Quote: ... The optimized sequence was cloned into a pET-28a (+) vector containing a kanamycin resistant gene (Genscript) and transformed into E ...
-
bioRxiv - Molecular Biology 2024Quote: ... the membrane was incubated with an anti-transthyretin antibody (1:1,000; Genscript) overnight in 5% milk in TBS-T ...
-
bioRxiv - Molecular Biology 2024Quote: ... and all plasmids were manufactured by Genscript (Piscataway, NJ). Plasmid DNAs were expanded and isolated using a Qiagen Maxiprep kit (Cat 12162 ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA fragments with wild type or mutation MTB DNA sequences were synthesized and cloned into pUC19 plasmid by GenScript (Figure 2). Concentrations of these plasmids are quantified by Bio-Rad ddPCR platform following the user guide ...
-
bioRxiv - Microbiology 2024Quote: ... The remaining systems were generated by and obtained from GenScript Biotech Corporation (EU Headquarters) ...
-
bioRxiv - Neuroscience 2024Quote: ... 8 µg of protein was loaded onto a 10% SurePAGE polyacrylamide gel (Genscript) and resolved for 1 cm ...
-
bioRxiv - Microbiology 2024Quote: ... lentiviruses were generated in HEK293T cells by transfection of pLentiCRISPRv2 -Puro plasmid containing a single guide RNA (sgRNA) (GTACTGTAGATGGTGCTCAT) (GenScript) targeting ACE2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... ancX-16 were codon optimized for Saccharomyces cerevisiae and synthesis by Genscript, China ...
-
bioRxiv - Molecular Biology 2024Quote: ... HA) (E1), HPV16 E2, pGL3 Basic, pGL3 Control, ptk6E2 (22, 68, 69) E2-K mutant plasmids were generated by GenScript.
-
bioRxiv - Molecular Biology 2024Quote: ... and were sequence verified (Genscript Piscataway). Details of standard virus production pipelines can be found at the Broad Institute’s Genetic Perturbation Platform website (https://portals.broadinstitute.org/gpp/public/) ...
-
bioRxiv - Immunology 2024Quote: ... the Thosea assigna virus (TAV) 2A protease and the mature IGIP was generated with a cloning spacer downstream and acquired from Genscript (Piscataway, NJ). The fragment was digested with AarI (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... the mutant clones of FANCJ K141/142A and K52R were individually generated using site-directed mutagenesis (Genscript) with PMT-BRD025 FANCJ WT (wild-type ...
-
bioRxiv - Immunology 2024Quote: ... gene over-expression studies were carried out using a mouse abcf1 construct expressed in the pcDNA 3.1 vector was purchased from GenScript (Clone Id: Omu73202; XM_006524122.2).
-
bioRxiv - Immunology 2024Quote: ... HR2 peptides were ordered from GenScript with an azide-modified N-terminal lysine (Fig ...
-
bioRxiv - Microbiology 2024Quote: ... Peptides were custom-synthesized and purchased from Genscript, USA (see Fig ...
-
bioRxiv - Microbiology 2024Quote: ... The EspE antibody (1:5,000 dilution) was a custom rabbit polyclonal antibody against the CGQQATLVSDKKEDD peptide (Genscript).
-
bioRxiv - Molecular Biology 2024Quote: ... cerevisiae and subcloned between PGK1 promoter and CYC1 terminator of Y22-PE by Genscript, China.
-
bioRxiv - Neuroscience 2024Quote: ... and supernatant was loaded to anti-Flag M2 affinity resin (GenScript), washed in buffer containing 25 mM HEPES pH 7.4 ...
-
bioRxiv - Neuroscience 2024Quote: ... as determined by mass spectrometry and HPLC (GenScript Corp, Piscataway, NJ).
-
bioRxiv - Neuroscience 2024Quote: All the peptides were synthesized by GenScript and purified to ≥98% ...
-
bioRxiv - Molecular Biology 2024Quote: ... (2021),synthesized by GenScript (GenScript, New Jersey ...
-
bioRxiv - Molecular Biology 2024Quote: ... (2021),synthesized by GenScript (GenScript ...
-
bioRxiv - Microbiology 2024Quote: ... The novel oriTs and relaxase operons were synthesized de novo and cloned into pCOLADuetTM-1 by GenScript USA Inc ...
-
bioRxiv - Neuroscience 2024Quote: ... New constructs were commercially synthesized and subcloned into either the pCA LNL or pCig2 plasmid backbones by GenScript (Piscataway, NJ). Subsequent exchange of expression vectors between pCig2 and pCA LNL and other subcloning were performed in house using standard procedures ...
-
bioRxiv - Molecular Biology 2024Quote: ... Other pAAV-related plasmids were developed by modifying these plasmids using standard molecular biology techniques and the GenBuilder Cloning kit (GenScript). PCR primers and oligonucleotides used were obtained from Integrated DNA Technologies (IDT) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... the former generated via gene synthesis (GenScript), the latter cloned directly from a cDNA library [30] ...
-
bioRxiv - Neuroscience 2024Quote: ... the strTeTx::P2A::mScarlet sequence was synthesized by GenScript (Piscataway, NJ). The Sr-gcy-9 promoter was then subcloned from pMLC29 into the strTeTx::P2A::mScarlet construct to generate pNB11.
-
bioRxiv - Cell Biology 2024Quote: ... occludin and GFP (#A01388, rabbit polyclonal, GenScript). GAPDH (#AB0060 ...
-
bioRxiv - Microbiology 2024Quote: Synthetic plasmids (pUC57 derivative) expressing the mature parts of bacteriocins under the control of the T7 promoter were provided by GenScript (Piscataway, NJ). These plasmids (Table S6 ...
-
bioRxiv - Microbiology 2024Quote: ... Inserts of interest were cloned by Genscript in a low copy vector (pQE60 ...
-
bioRxiv - Immunology 2024Quote: ... The synthesized genes were subcloned into a SFG88 retroviral vector and the identity of the new sequences was confirmed by Sanger sequencing (Genscript). Similarly ...
-
bioRxiv - Immunology 2024Quote: ... tEGFR and ΔFAS sequences were separated by P2A motifs and synthesized by Genscript. The synthesized genes were subcloned into a SFG88 retroviral vector and the identity of the new sequences was confirmed by Sanger sequencing (Genscript) ...
-
bioRxiv - Immunology 2024Quote: ... NLS-mCherry and NLS-GFP sequences were synthesized and cloned into an SFG vector by Genscript. For transfection of the plasmids mentioned above ...
-
bioRxiv - Molecular Biology 2024Quote: Polyclonal rabbit antibodies against phopsho-TRF1 and TRF2 were generated by Genscript. Briefly ...
-
bioRxiv - Molecular Biology 2024Quote: ... and synthesised by GenScript. All plasmids used in this study are available from Addgene.
-
bioRxiv - Immunology 2024Quote: ... The biotin-K417N peptide (VRQIAPGQTGNIADYNYKLP ; GenScript) was mixed with the streptavidin-AF647 in a 4:1 ratio at room temperature for 2 hours ...
-
bioRxiv - Immunology 2024Quote: ... 50 ng/mL of IL-2 (Z02764, GenScript), 10 ng/mL of IL-4 (HY-P70653 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Vectors encoding either intron 2 retained PSMB8 (i2R-PSMB8) or the canonical full-length transcript (FL-PSMB8) in pcDNA3.1 were obtained from GenScript, outgrown in DH5α E ...
-
bioRxiv - Biochemistry 2024Quote: ... Site-directed mutant gene fragments were commercially synthesized (GenScript Inc).