Labshake search
Citations for GenScript :
351 - 400 of 5821 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... Transfer was done at 20 V for 1 hour buffer containing 25 mM Tris base and 25 mM Bicine (M00139, GenScript) supplemented with 10% absolute ethanol (20821.330 ...
-
bioRxiv - Developmental Biology 2024Quote: ... the NotI-gChSPL9:Venus-NotI and miR156-resistant version NotI-pChSPL9::ChSPL9r:Venus-NotI were synthesized (GenScript) and transferred to the pMLBart vector via Not I cloning ...
-
bioRxiv - Genetics 2024Quote: ... The oligonucleotide library was procured from GenScript (USA) and subsequently amplified employing the Phusion® High-Fidelity DNA Polymerase (NEB) ...
-
bioRxiv - Genetics 2024Quote: ... Sections (iv) was synthetized by outsourcing company (GenScript).
-
bioRxiv - Immunology 2024Quote: All 9mer and 21mer neoantigen peptides used for in vitro and in vivo experiments were purchased from GenScript (Piscataway, NJ). For 21mer neoantigen peptides ...
-
bioRxiv - Immunology 2024Quote: ... 293F cells were transfected with plasmids containing Spike protein (ATUM plasmid pD2528-CMV with insert QHD43416.1) and Spike-2P protein (site-directed mutagenesis to generate the 2P mutation on the plasmid containing Spike protein, GenScript) by 293fectinTM transfection reagent (Gibco ...
-
bioRxiv - Immunology 2024Quote: Total IgG was from 3 mL human serum from a patient vaccinated against SARS-CoV-2 using protein G agarose resin (Genscript). Protein G resin was washed with PBS and eluted with 0.1M glycine buffer ...
-
bioRxiv - Genomics 2024Quote: ... were then synthesised by GenScript and initially cloned into pLVX-IRES-ZsGreen1 lentiviral vector (Takara Bio ...
-
bioRxiv - Genomics 2024Quote: SHIWSC3_PJ0001 was synthesized and cloned (via NdeI/BamHI sites) by GenScript (Oxford, United Kingdom) into the expression vector pET-28a (+)-TEV (using the gene without the initial 36 bp) ...
-
bioRxiv - Genomics 2024Quote: ... and shRNA oligos for insertion (Table 1) were synthesized by GenScript. Oligos were reconstituted in water at a concentration of 100 μM ...
-
bioRxiv - Developmental Biology 2024Quote: ... the membranes were incubated overnight at 4°C with anti-zebrafish Ybx1 primary antibody we prepared previously (1:2000) (GenScript, Nanjing, China) (26) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 0.1% SDS and 0.1 mM EDTA (M00138, GenScript) at 100V for 200 min in a Mini Gel Tank system (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2024Quote: Plasmid pHIPZ Tpo4 3xHA was obtained from GenScript, and constructed as follows ...
-
bioRxiv - Cell Biology 2024Quote: ... a synthetic gene fragment of VPS5 (ordered from GenScript) containing containing the following mutations - start codon of VAM10 sequence(M-to-I) ...
-
bioRxiv - Cell Biology 2024Quote: ... Chk2 was eluted from the beads by addition of PreScission Protease (Genscript Z02799) overnight rocking at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... the reaction products were loaded onto 4∼20% SDS-PAGE gels (GenScript Biotech, China), and then the signals were obtained by western blotting.
-
bioRxiv - Cell Biology 2024Quote: ... Di-thiolated peptides that are susceptible to metalloproteinase (MMP) cleavage (GCNSVPMSMRGGSNCG) and thiolated cell-adhesive peptides (GCGYGRGDSPG) were obtained from Genscript. HA hydrogels were fabricated by mixing 4 wt% norbornene-modified HA with 0.05 wt% photo-initiator lithium phenyl-2,4,6-trimethylbenzoylphosphinate (LAP ...
-
bioRxiv - Cell Biology 2024Quote: ... and then subjected to denaturation at 100 °C for 10 min after the addition of 4X protein loading buffer (GenScript Biotech, China). Then ...
-
bioRxiv - Cell Biology 2024Quote: ... using an eBlot™ L1 wet transfer (GenScript Biotech, China). Membranes were blocked and incubated with primary antibodies and secondary antibodies using eZwest Lite Automated Western Device (GenScript Biotech ...
-
bioRxiv - Cell Biology 2024Quote: ... Membranes were blocked and incubated with primary antibodies and secondary antibodies using eZwest Lite Automated Western Device (GenScript Biotech, China). Membranes were then incubated with Omni-ECL™Femto Light Chemiluminescence Kit (Epizyme ...
-
bioRxiv - Cell Biology 2024Quote: Wild-type and analog-sensitive Chk2 ORF sequences were cloned in the pGex6p-1 plasmid (Genscript, see plasmid construction section for details ...
-
bioRxiv - Developmental Biology 2024Quote: ... A mixture of 100 ng/µL Cas9 protein (GenScript, New Jersey, USA) and 300 ng/µL gRNA for the injection into the eggs (per egg 2 nL was injected ...
-
bioRxiv - Developmental Biology 2024Quote: ... The CRISPRi library sgRNA oligos with Bsmb1 overhangs were synthesized by GenScript (Piscataway, NJ) and cloned into the lentiviral vector pXPR_050 by Golden Gate cloning following published protocols57 ...
-
bioRxiv - Immunology 2024Quote: ... or IgG (Cat #A01008, GenScript) were added and beads were rotated at 4°C for 5 hr ...
-
bioRxiv - Immunology 2024Quote: ... and incubated with FITC conjugated anti-FLAG mouse monoclonal antibody (GenScript, Cat. No. A01632) at a concentration of 2 µg per million cells for 1 hr at 37 C in the dark ...
-
bioRxiv - Immunology 2024Quote: ... identical amounts and volumes of protein lysate from either untransfected or transfected cells were added to 20 μl of anti-DYKDDDDK G1 Affinity Resin (GenScript, Cat. No. L00432), previously washed with TBS 0.1% Tween™ 20 (TBS-T) ...
-
bioRxiv - Immunology 2024Quote: ... Five hundred thousand splenocytes were plated with 500 nM of an irrelevant peptide (hen egg lysozyme HEL11-25: AMKRHGLDNYRGYSL) or the BDC2.5 mimetic peptide (P63: RTRPLWVRME) (GenScript). After 20 hours of co-incubation ...
-
bioRxiv - Genomics 2024Quote: ... were synthesized de novo and cloned into pUC57 Kan-r (GenScript, Piscataway NJ) as entry vectors suitable for Gateway cloning (72) ...
-
bioRxiv - Immunology 2024Quote: ... by Genscript. The human DPP4 ectodomain (39–766 ...
-
bioRxiv - Immunology 2024Quote: ... and inserted into pcDNA3.1(+) by Genscript. The light chain Fab sequence for these antibodies with an N-terminal µ-phosphatase or mouse Ig heavy signal peptide sequence were codon optimized ...
-
bioRxiv - Immunology 2024Quote: ... and inserted into pcDNA3.1(+) by Genscript. The MERS-CoV NTD (1–357 ...
-
bioRxiv - Immunology 2024Quote: ... and inserted into pcDNA3.1(+) by Genscript. The heavy chain Fab sequences for LCA60 ...
-
bioRxiv - Immunology 2024Quote: ... spleen single cell suspensions were incubated for 4h at 37°C in the presence of gp33 peptide (1 µg/mL KAVYNFATC; Genscript), brefeldin A (5 µg/mL ...
-
bioRxiv - Microbiology 2024Quote: ... followed by staining of cells with primary rabbit anti-SARS-CoV-2 N Wuhan-1 antibody (Genscript U739BGB150-5) (1:2000 dilution ...
-
bioRxiv - Immunology 2024Quote: All constructs contained a C-terminal histidine affinity tag and were codon optimized by GenScript for mammalian cell expression ...
-
bioRxiv - Microbiology 2024Quote: ... and BA.2.87.1 plasmids were all synthesized by GenScript Biotech (Piscataway ...
-
bioRxiv - Immunology 2024Quote: All constructs were generated by inserting synthesized and codon optimized target sequences (GenScript) into a lentiviral transfer plasmid backbone containing an EF1α promoter to drive target gene expression ...
-
bioRxiv - Immunology 2024Quote: ... cloning and mutagenesis were performed by GenScript (USA). Amino acids are numbered according to the canonical HxB2 subtype B reference strain.
-
bioRxiv - Immunology 2024Quote: ... was obtained from GenScript (OHu21369). PCR was performed to add the 3XFlag tag to the N terminus of ZBP1 cDNA at the 5’ Not1 site and 3’ Sal1 site to facilitate cloning into expressing vector p3XFlag-CMV-7.1 (Sigma) ...
-
bioRxiv - Immunology 2024Quote: ... for expression in HEK293T or tagged with FLAG-HA then cloned into the pUC57-mini vector (synthesized by Genscript) to be used as template for in vitro mRNA transcription ...
-
bioRxiv - Immunology 2024Quote: ... G12V-TCR alpha chain (1-206) and G12V-TCR beta chain (1-246) were synthesized by Genscript (USA) and cloned into the pET30a+ vector ...
-
bioRxiv - Immunology 2024Quote: ... A plasmid encoding full length G12V-TCR in the format TCRα-T2A-TCRβ was synthesized by Genscript and cloned into pcDNA3.1 ...
-
bioRxiv - Immunology 2024Quote: ... A3-peptide-β2M complexes were refolded by adding 10 mg of peptide (Genscript USA, dissolved in DMSO). TCR was refolded by adding 30 mg of TCRα and TCRβ into 1L refolding buffer containing 0.4 Arginine ...
-
bioRxiv - Microbiology 2024Quote: Synthetic plasmids (pUC57 derivative) expressing the mature parts of bacteriocins under the control of the T7 promoter were provided by GenScript (Piscataway, NJ). These plasmids (Table S6 ...
-
bioRxiv - Microbiology 2024Quote: ... Inserts of interest were cloned by Genscript in a low copy vector (pQE60 ...
-
bioRxiv - Molecular Biology 2024Quote: ... using a GenBuilder Cloning kit (GenScript). Reporter loxP-2272 was generated by substituting the lox17:N site (ATAACTTCGTATAGTATACCTTATAGCAATTTAT ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... the former generated via gene synthesis (GenScript), the latter cloned directly from a cDNA library [30] ...
-
bioRxiv - Neuroscience 2024Quote: ... the strTeTx::P2A::mScarlet sequence was synthesized by GenScript (Piscataway, NJ). The Sr-gcy-9 promoter was then subcloned from pMLC29 into the strTeTx::P2A::mScarlet construct to generate pNB11.
-
bioRxiv - Microbiology 2024Quote: ... using anti-His (mouse) primary antibody (GenScript) at a dilution of 1:3,000 ...
-
bioRxiv - Microbiology 2024Quote: ... followed by primary staining of cells with rabbit anti-N Wuhan-1 antibody (Genscript U739BGB150-5) (1:2000 dilution ...