Labshake search
Citations for GenScript :
1 - 50 of 6439 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: Plasmids were synthesized and cloned by Genscript. The vector for all P ...
-
bioRxiv - Microbiology 2024Quote: ... using synthetic and codon-optimized DNA provided by GenScript Europe (The Netherlands) ...
-
bioRxiv - Microbiology 2024Quote: ... The murine-human chimeric heavy and light chain sequences were then cloned into pGenDONR by GenScript, with a P2A sequence added between the heavy and light chain sequences to create the pGenDONR-IgG H1-P2A-Ig(λ ...
-
bioRxiv - Microbiology 2024Quote: ... anti-EBV BALF0/1 rabbit mAb (generated by Genscript for this study), anti-EBV ZEBRA Mouse mAb (BZ1 ...
-
bioRxiv - Immunology 2024Quote: Cxcr6 expressing plasmid was generated by cloning Cxcr6 gene block amplified from ORF (GenScript) into MSCV-IRES-GFP backbone (Addgene # 20672) ...
-
bioRxiv - Microbiology 2024Quote: A 17 amino acid mature SilCR peptide (DIFKLVIDHISMKARKK) was synthesized by Genscript. After reconstitution ...
-
bioRxiv - Cancer Biology 2024Quote: ... cDNA for GFP and Luciferase were synthesized by GENEWIZ and cDNA for Gstm3 were synthesized from Genscript. Gateway sites were added to the cDNA through PCR and genes of interest were then used to replace the CcdB gene by Gateway recombination (Invitrogen #11789100 and #11791100) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and diluted 1:5000 HRP-conjugated goat anti-rabbit IgG (cat no. A00098, GenScript) were used as secondary antibodies ...
-
bioRxiv - Cancer Biology 2024Quote: ... Diluted 1:5000 horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG (cat no. A00160; GenScript) and diluted 1:5000 HRP-conjugated goat anti-rabbit IgG (cat no ...
-
bioRxiv - Cancer Biology 2024Quote: ... then samples were heated to 100°C for 5 min before being loaded into individual lanes of 4-12% SurePAGE™ Bis-Tris polyacrylamide gels (GenScipt, Piscataway, NJ, USA) and separated with electrophoresis within MES SDS running buffer (M00677; GenScript), using a Mini PREOTEAN 3 cell (525BR058974 ...
-
bioRxiv - Cancer Biology 2024Quote: The pcDNA5/FRT/TO-Myc-FEN1 WT and E359K plasmids were synthesized by Genscript and include siResistance to FEN1 exon 2 siRNA GAUGCCUCUAUGAGCAUUUAU ...
-
bioRxiv - Cancer Biology 2024Quote: ... E84A and K577M plasmids were synthesized by Genscript and include siResistance to both WRN exon 9 siRNA GAGGGUUUCUAUCUUACUA and WRN exon17 siRNA AUACGUAACUCCAGAAUAC.
-
bioRxiv - Cell Biology 2024Quote: Heavy-labelled synthetic standards for all peptides mentioned in supplemental Table S2 were acquired from SpikeTides (JPT) or custom synthesis (GenScript) with the following chemical modifications ...
-
bioRxiv - Molecular Biology 2024Quote: ... The nucleotide sequence was synthesized by Genscript and cloned into the in vitro transcription/translation plasmid vector pCITE-4a(+ ...
-
bioRxiv - Cancer Biology 2024Quote: ... rabbit polyclonal β-catenin(A01211-40; Genscript, China), rabbit polyclonal YAP1(A1002 ...
-
bioRxiv - Cancer Biology 2024Quote: ... using the eBlot™ L1 Fast Wet Transfer System (GenScript) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... occludin and GFP (#A01388, rabbit polyclonal, GenScript). GAPDH (#AB0060 ...
-
bioRxiv - Microbiology 2024Quote: ... GenScript (GenScript USA Inc., Piscataway, NJ, USA) performed the cloning procedure ...
-
bioRxiv - Molecular Biology 2024Quote: ... while the R1 peptide (VFAEFLPLFSKFGSRMHILK) (GenScript at 98% purity). The first anti-GYPC antibody we tested ...
-
bioRxiv - Molecular Biology 2024Quote: ... Affinity-purified rabbit polyclonal antibodies specific to each eIF4E family member (Genscript) were used as the primary probe in western blotting ...
-
bioRxiv - Neuroscience 2024Quote: ... 2000) was codon optimized for human cells and synthesized into a pcDNA 3.1(+) vector by Genscript. Codon-optimized G5A and Gqi5/9 sequences as well as cloning primers and further details are provided in Supplementary file 7.
-
bioRxiv - Cell Biology 2024Quote: ... abcg2c (XM_005156523) or abcg2d (NM_001042772) (all from Genscript, Piscataway, NJ), flanked by a C-terminal FLAG tag sequence ...
-
bioRxiv - Developmental Biology 2024Quote: ... a second loxP and the restriction site XhoI was synthetized (Genscript) and cloned between 5’ and 3’ homology arms amplified by PCR using Gibson assembly ...
-
bioRxiv - Plant Biology 2024Quote: ... a synthetic and codon-optimized DNA fragment (GenScript, Leiden, Netherlands) referring to a hybrid MtABCG40 sequence ...
-
bioRxiv - Plant Biology 2024Quote: ... was cloned into pMDC43 vector between the SgsI (AscI) and PacI restriction sites (GenScript) (Curtis and Grossniklaus 2003) ...
-
bioRxiv - Plant Biology 2024Quote: ... ATPase-deficient version of MtABCG40 (MtABCG40-ATPase - E344Q and E1029Q) was generated by GenScript.
-
bioRxiv - Synthetic Biology 2024Quote: mRNA and gRNA were synthesized and packaged in LNP with ionizable lipid ALC0315 by Genscript. Briefly ...
-
bioRxiv - Synthetic Biology 2024Quote: ... LNP #3 (ALC0315) and LNP #4 (LP01) encapsulating f-luciferase mRNA also were provided by Genscript.
-
bioRxiv - Cancer Biology 2024Quote: ... and 3U/ml Epo (GenScript, #Z02975-50). In phase 2 (days 7-11) ...
-
bioRxiv - Bioengineering 2024Quote: ... washed and incubated with 0.1 μM anti-HA-FITC antibody and 0.1 μM anti-FLAG-iFluor 647 antibody (GenScript, Nanjing, China) for 15 min in dark ...
-
bioRxiv - Microbiology 2024Quote: ... regions of 400 bp flanking a gene of interest (Up and Down regions) were obtained by gene synthesis (GenScript) as a fused 800 bp fragment (SI Appendix ...
-
bioRxiv - Cell Biology 2024Quote: A E.coli codon optimized DNA fragment corresponding to amino acids 32-442 of RON11 was synthesized (Genscript) and cloned into pMAL vector (NEB ...
-
bioRxiv - Cell Biology 2024Quote: ... Clarified lysates were incubated with 1 mL Anti-DYKDDDDK (FLAG) Affinity Resin (Genscript; Piscataway, NJ) for 2 h at 4 °C and then washed with 10 column volumes (CVs ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 mg/mL 3X-FLAG peptide (Genscript). Final purification was achieved by size exclusion chromatography (SEC ...
-
bioRxiv - Biochemistry 2024Quote: ... Purified EGF-like domain of NRG1ý or BTC was incubated with anti-DYKDDDDK G1 affinity resin (Genscript, short anti-Flag) for 1 hour at 4 °C and serially washed 3x with Buffer A (50 mM Tris-HCl pH 7.4 ...
-
bioRxiv - Bioengineering 2024Quote: ... with di-thiol peptide crosslinkers that were either broadly protease-degradable (KKCGGPQGIWGQGCKK, Genscript) or non-degradable (KKCGGDQGIAGFGCKK ...
-
bioRxiv - Bioengineering 2024Quote: ... or non-degradable (KKCGGDQGIAGFGCKK, Genscript). HA hydrogels had a total peptide crosslinker concentration of 0.838 mM for H80 ...
-
bioRxiv - Bioengineering 2024Quote: ... methacrylated HA was functionalized with cysteine-TMR (Genscript) at a concentration of 0.075 mM ...
-
bioRxiv - Biochemistry 2024Quote: ... Equivalent aliquots (15 µL) of each fraction were analysed by SDS-PAGE and immunoblotting using anti-His tag antibody (GenScript) overnight at 4°C as per manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... the cells were spun down at 4000 g for 30 min at 4 °C and GLA protein was purified by batch binding with 2.5 mL of Anti-DYKDDDDK G1 Affinity Resin (L00432, Genscript) in the harvested and 0.8 μm filtered supernatant ...
-
bioRxiv - Bioengineering 2024Quote: ... Dicysteine peptide Ac-GCRDLPESGGPQGIWGQDRCG-NH2 (4S9 degradable sequence, MMP-degradable sequence) was purchased from Genscript (Piscataway, NJ), resuspended in 10% glacial acetic acid ...
-
bioRxiv - Biochemistry 2024Quote: ... and inserted into the pcDNA3.1(+) vector by Genscript. The membrane-anchored TMPRSS2 and TMPRSS2 ectodomain constructs were codon-optimized ...
-
bioRxiv - Biochemistry 2024Quote: ... and inserted the pcDNA3.1(+) vector by Genscript. The HKU1 RBD constructs encoding S residues 320-614 of the wildtype isolate N1 (ref ...
-
bioRxiv - Biochemistry 2024Quote: ... was synthesized and cloned into the pET-28a vector (Genscript Ltd). The plasmid was transformed into E ...
-
bioRxiv - Biochemistry 2024Quote: ... was synthesized from GenScript at ≥98% purity ...
-
bioRxiv - Biochemistry 2024Quote: ... The reaction was stopped at different time points by adding Laemmli sample buffer and incubating the samples 5 min at 95 °C before loading them on Bis-Tris-SDS 4-20% polyacrylamide gels (SurePAGE, GenScript).
-
bioRxiv - Biochemistry 2024Quote: ... gene was codon-optimized and cloned into the p423_GAL1 yeast expression vector as an N-terminal Flag (DYKDDDDK) and C-terminal deca-histidine (10X His) tagged fusion protein (GenScript) (Supplementary Fig ...
-
bioRxiv - Biochemistry 2024Quote: ... and purification of “Ceres” were performed by GenScript (Piscataway, NJ, USA). In brief ...
-
bioRxiv - Biochemistry 2024Quote: ... Tris-MOPS-SDS gels (GenScript). The resolved proteins were then transferred to PVDF membranes (BioRad) ...
-
bioRxiv - Biochemistry 2024Quote: ... synthesized and cloned into the pET-26b(+) expression vector using NdeI/XhoI restriction sites by GenScript (Piscataway, NJ, USA). The resulting vector was used to transform One Shot™ BL21 Star™ (DE3 ...