Labshake search
Citations for GenScript :
301 - 350 of 6194 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... and Tp0870 (70% purity, Genscript). Peptides were resuspended in dimethylsulfoxide (DMSO ...
-
bioRxiv - Immunology 2024Quote: ... A3-peptide-β2M complexes were refolded by adding 10 mg of peptide (Genscript USA, dissolved in DMSO). TCR was refolded by adding 30 mg of TCRα and TCRβ into 1L refolding buffer containing 0.4 Arginine ...
-
bioRxiv - Immunology 2024Quote: ... or IgG (Cat #A01008, GenScript) were added and beads were rotated at 4°C for 5 hr ...
-
bioRxiv - Immunology 2024Quote: ... 293F cells were transfected with plasmids containing Spike protein (ATUM plasmid pD2528-CMV with insert QHD43416.1) and Spike-2P protein (site-directed mutagenesis to generate the 2P mutation on the plasmid containing Spike protein, GenScript) by 293fectinTM transfection reagent (Gibco ...
-
bioRxiv - Immunology 2024Quote: Total IgG was from 3 mL human serum from a patient vaccinated against SARS-CoV-2 using protein G agarose resin (Genscript). Protein G resin was washed with PBS and eluted with 0.1M glycine buffer ...
-
bioRxiv - Microbiology 2024Quote: ... and BA.2.87.1 plasmids were all synthesized by GenScript Biotech (Piscataway ...
-
bioRxiv - Immunology 2024Quote: ... Five hundred thousand splenocytes were plated with 500 nM of an irrelevant peptide (hen egg lysozyme HEL11-25: AMKRHGLDNYRGYSL) or the BDC2.5 mimetic peptide (P63: RTRPLWVRME) (GenScript). After 20 hours of co-incubation ...
-
bioRxiv - Genomics 2024Quote: ... were synthesized de novo and cloned into pUC57 Kan-r (GenScript, Piscataway NJ) as entry vectors suitable for Gateway cloning (72) ...
-
bioRxiv - Immunology 2024Quote: ... by Genscript. The human DPP4 ectodomain (39–766 ...
-
bioRxiv - Immunology 2024Quote: ... and incubated with FITC conjugated anti-FLAG mouse monoclonal antibody (GenScript, Cat. No. A01632) at a concentration of 2 µg per million cells for 1 hr at 37 C in the dark ...
-
bioRxiv - Immunology 2024Quote: ... identical amounts and volumes of protein lysate from either untransfected or transfected cells were added to 20 μl of anti-DYKDDDDK G1 Affinity Resin (GenScript, Cat. No. L00432), previously washed with TBS 0.1% Tween™ 20 (TBS-T) ...
-
bioRxiv - Microbiology 2024Quote: ... using synthetic and codon-optimized DNA provided by GenScript Europe (The Netherlands) ...
-
bioRxiv - Microbiology 2024Quote: ... ABCB7 sequence with added MfeI and NsiI restriction sites was synthesised (GenScript) and cloned into a pTUB8mycGFPMyoATy expression vector (38) ...
-
bioRxiv - Immunology 2024Quote: Cxcr6 expressing plasmid was generated by cloning Cxcr6 gene block amplified from ORF (GenScript) into MSCV-IRES-GFP backbone (Addgene # 20672) ...
-
bioRxiv - Immunology 2024Quote: ... genes were synthesized and cloned into pHLSec or its variant pCWSec by Genscript inc ...
-
bioRxiv - Immunology 2024Quote: ... spleen single cell suspensions were incubated for 4h at 37°C in the presence of gp33 peptide (1 µg/mL KAVYNFATC; Genscript), brefeldin A (5 µg/mL ...
-
bioRxiv - Immunology 2024Quote: Cognate VH and VL antibody sequences of interest were synthesized and cloned into a customized pcDNA 3.4 vector containing a human IgG1 Fc region by GenScript Biotech ...
-
bioRxiv - Immunology 2024Quote: ... was obtained from GenScript (OHu21369). PCR was performed to add the 3XFlag tag to the N terminus of ZBP1 cDNA at the 5’ Not1 site and 3’ Sal1 site to facilitate cloning into expressing vector p3XFlag-CMV-7.1 (Sigma) ...
-
bioRxiv - Immunology 2024Quote: ... M2 ORF of Ca/04 and 83 nucleotides of the 3’ end of the PB1 gene (40 nucleotides encoding the C-terminus of PB1 ORF and 43 from the 3’UTR region) was synthesized by Genscript (Piscataway, NJ). The fragments were digested with BsmBI ...
-
bioRxiv - Immunology 2024Quote: ... coli lysate (GenScript, Piscataway, NJ, USA) to a final concentration of 10 mg/mL and preincubated at room temperature (RT ...
-
bioRxiv - Cell Biology 2024Quote: FITC-labeled aminocaproic acid-disulfide-cyclized ACRGDGWCG peptide (FITC-cyclic-ACRGDGWCG) and FITC-labeled aminocaproic acid-GRGDLGRLKK peptide (FITC-proTGFβ3 peptide) were synthesized by GenScript. Preliminary experiments (Supplementary Fig ...
-
bioRxiv - Cell Biology 2024Quote: cDNA encoding native integrin α and β-subunits from Genscript (gene and accession No ...
-
bioRxiv - Bioengineering 2024Quote: ... with di-thiol peptide crosslinkers that were either broadly protease-degradable (KKCGGPQGIWGQGCKK, Genscript) or non-degradable (KKCGGDQGIAGFGCKK ...
-
bioRxiv - Bioengineering 2024Quote: ... or non-degradable (KKCGGDQGIAGFGCKK, Genscript). HA hydrogels had a total peptide crosslinker concentration of 0.838 mM for H80 ...
-
bioRxiv - Bioengineering 2024Quote: ... methacrylated HA was functionalized with cysteine-TMR (Genscript) at a concentration of 0.075 mM ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 mg/mL 3X-FLAG peptide (Genscript). Final purification was achieved by size exclusion chromatography (SEC ...
-
bioRxiv - Biochemistry 2024Quote: ... coli expressed saposins: We purchased from Genscript (Piscataway, NJ, USA) the codon-optimized SapB and SapD (UniProt P07602 ...
-
bioRxiv - Biochemistry 2024Quote: ... His-tagged Enterokinase (Z03004, Genscript) was added to the dialyzed ...
-
bioRxiv - Biochemistry 2024Quote: Sf9 expressed GLA: We purchased from Genscript the codon-optimized wild-type and D170A mutant human GLA (UniProt P06280 ...
-
bioRxiv - Biochemistry 2024Quote: ... the cells were spun down at 4000 g for 30 min at 4 °C and GLA protein was purified by batch binding with 2.5 mL of Anti-DYKDDDDK G1 Affinity Resin (L00432, Genscript) in the harvested and 0.8 μm filtered supernatant ...
-
bioRxiv - Biochemistry 2024Quote: ... Both the constructs were outsourced from GenScript, USA ...
-
bioRxiv - Biochemistry 2024Quote: ... Equivalent aliquots (15 µL) of each fraction were analysed by SDS-PAGE and immunoblotting using anti-His tag antibody (GenScript) overnight at 4°C as per manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: Codon optimized sequences of NAPstar3b and HyPer7 for expression in mammalian cells were commercially synthesized (Supplementary Table 4) (GenScript Biotech, Rijswijk, Netherlands) and delivered in pcDNA3.1(+ ...
-
bioRxiv - Biochemistry 2024Quote: NAPstar sequences for plant expression were commercially synthesized with codons optimized for plant expression (GenScript Biotech, Rijswijk, Netherlands) and inserted into pDONR207 (LIFE Technologies ...
-
bioRxiv - Biochemistry 2024Quote: ... Cloning and mutagenesis of those genes were also performed by Genscript. The RBD was cloned into pCAGGS ...
-
bioRxiv - Biochemistry 2024Quote: ... the RBD and subdomain-1 (RBD-SD1, residues 307-675) and human TMPRSS2 (residues 107-492, NCBI accession O15393) were obtained from Genscript. Cloning and mutagenesis of those genes were also performed by Genscript ...
-
bioRxiv - Biochemistry 2024Quote: ... 500 bp upstream and downstream of the coxM C-terminus were fused to a twin-Strep II tag (5’GGCGGTTCGGGCTGGTCCCACCCCCAGTTCGAAAAGGGTGGGGGCTCCGGTGGCGGGTCGGGTGGGTCC GCCTGGTCGCACCCGCAGTTCGAGAAG 3’) in a 1111 bp fragment synthesised by Genscript. Two ∼500bp fragments upstream and downstream of the coxG gene were fused to create a deletion construct of 1011 bp and synthesised by Genscript ...
-
bioRxiv - Biochemistry 2024Quote: A tdTomato expression plasmid was generated from plasmid pJP72.26 The tdTomato gene was synthesized by GenScript with codons optimized for Capsaspora ...
-
bioRxiv - Biochemistry 2024Quote: ... and was purchased from GenScript (Rijswijk, Netherlands). It includes two non-native tryptophan (W ...
-
bioRxiv - Biochemistry 2024Quote: ... PFD5 (GenScript, NM_002624); and cMyc (GenScript ...
-
bioRxiv - Biochemistry 2024Quote: ... C-terminally FLAG tagged constructs in pcDNA: PFD3 (GenScript, NM_003372), PFD5 (GenScript ...
-
bioRxiv - Biochemistry 2024Quote: ... and cloned into pFastBac1 or pFastbac Dual vectors by Genscript. Second generation baculoviruses (P1 ...
-
bioRxiv - Biochemistry 2024Quote: Synthetic DNA sequences (GenScript) containing the sequences of the globular domains (excluding N-terminal proteolipidic signal peptide ...
-
bioRxiv - Biochemistry 2024Quote: All peptides in their Nt-Met and Nt-fMet forms were synthesized by GenScript. For oxidation experiments ...
-
bioRxiv - Biochemistry 2024Quote: Plasmids for protein expression were ordered from Genscript (gene synthesis ...
-
bioRxiv - Biochemistry 2024Quote: ... Two ∼500bp fragments upstream and downstream of the coxG gene were fused to create a deletion construct of 1011 bp and synthesised by Genscript. The fragments were cloned into the SpeI site of the mycobacterial shuttle plasmid pX33 and transformed into M ...
-
bioRxiv - Biochemistry 2024Quote: ... Cell debris were removed by centrifugation (10,000 x g for 10 min at 4°C) and the supernatant was incubated with 30 μL of protein A/G-coated magnetic beads (Genscript L00277) for 1 hour at 4 °C to remove nonspecifically bound proteins ...
-
bioRxiv - Biochemistry 2024Quote: Subunit specific fluorogenic substrates were custom synthesized and purified by HPLC to >95% by GenScript (New Jersey). Substrates contained either an N-terminal acetylation group and a C-terminal amc group ...
-
bioRxiv - Biochemistry 2024Quote: ... with a 3’ BamHI site was used to replace the equivalent EcoRI-BamHI fragment in a pT5P carrying full-length Taq polymerase (supplied by Genscript). See Supplementary materials (Figure S2) ...
-
bioRxiv - Biophysics 2024Quote: ... The plasmid encoding for Mini-GαS was obtained from Genscript and designed to be identical to the sequence of the Mini-GαS ‘393’ sequence (25).