Labshake search
Citations for GenScript :
251 - 300 of 5821 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: Codon-optimised BA.2.87.1 spike was synthesised and cloned with Seamless cloning (GenScript). The production of all other codon-optimised spike constructs used here are as previously described1 ...
-
bioRxiv - Biochemistry 2024Quote: ... an FBXO3(NM_012175) ORF Clone was purchased from GenScript (Cat. #OHU25332D), and the open reading frame amplified using the primers listed in Supplementary Data ...
-
bioRxiv - Biochemistry 2024Quote: ... and cMyc (GenScript, NM_002467) in pcDNA ...
-
bioRxiv - Biochemistry 2024Quote: ... coli expression (Genscript ltd.). The gene was cloned with an inducible promoter into a pGex-6p-1 plasmid containing an N-terminus GST (glutathione transferase ...
-
bioRxiv - Immunology 2024Quote: ... T2A sequence and an anti-CD19 single-chain variable fragment (scFv) fused to 4-1BB and CD3ζ stimulatory endodomains (for TRAC-CAR19-KI) were subcloned into recombinant AAV6 plasmids (GenScript). DNA sequences were flanked with 400 base-pair homology arms immediately upstream and downstream of the TET2 gRNA or TRAC gRNA cut sites ...
-
bioRxiv - Biochemistry 2024Quote: ... Constructs were synthesized by Genscript (Fig. 4A). The FXR LBD (residues 247-476 ...
-
bioRxiv - Molecular Biology 2024Quote: ... fully loaded and separated using a 12% SDS-PAGE (SurePage Bis-Tris, Genscript, Piscataway, NJ, USA) run with MES buffer (50 mM 2-(N-morpholino)ethane sulfonic acid (MES) ...
-
bioRxiv - Biophysics 2024Quote: ... and cloned into a pUC19 vector by GenScript (Jiangsu, China). For each plasmid ...
-
bioRxiv - Neuroscience 2024Quote: ... UAS-KCR1-GS and UAS-WiChR transgenic lines were generated by de novo synthesis (Genscript) of Drosophila codon-optimized HcKCR insert sequences 43 (Genbank #MZ826861 and #MZ826862 ...
-
bioRxiv - Neuroscience 2024Quote: ... ACR and KCR construct variants were cloned into the multiple cloning site of a pcDNA3.4 vector (Genscript) by XhoI and EcoRV restriction enzyme digest ...
-
bioRxiv - Neuroscience 2024Quote: ... After Sanger sequencing verification (Genscript), the fragments were cloned into an pJFRC7-20XUAS-IVS-mCD8::GFP vector (Addgene plasmid # 26220) ...
-
bioRxiv - Neuroscience 2024Quote: ... and all plasmids were manufactured by Genscript (Piscataway, NJ). Plasmid DNA was expanded and isolated using a QIAGEN Plasmid Maxi Kit (Germantown ...
-
bioRxiv - Neuroscience 2024Quote: ... An additional plasmid encoding green fluorescent protein (GFP; pCAG-GFP; GenScript), was used to label successfully transfected cells ...
-
bioRxiv - Molecular Biology 2024Quote: ... using a GenBuilder Cloning kit (GenScript). Reporter loxP-2272 was generated by substituting the lox17:N site (ATAACTTCGTATAGTATACCTTATAGCAATTTAT ...
-
bioRxiv - Microbiology 2024Quote: ... M-CSF (Genscript) for six days ...
-
bioRxiv - Microbiology 2024Quote: ... followed by primary staining of cells with rabbit anti-N Wuhan-1 antibody (Genscript U739BGB150-5) (1:2000 dilution ...
-
bioRxiv - Microbiology 2024Quote: ... produced by Genscript and provided in PBS41.
-
bioRxiv - Microbiology 2024Quote: ... placed into the sample cell and titrated with 3.2–4.8 μl aliquots of 0.1–1 mM peptide solutions (purchased from GenScript, Piscataway, NJ, USA), 2 mM SAM or 250 µM SAH ...
-
bioRxiv - Microbiology 2024Quote: ... homology arms containing 500-700 bp regions upstream and downstream of genes to be deleted were synthesized and cloned into pAK405 (Genscript, Piscataway, NJ). Constructs were mobilized into N ...
-
bioRxiv - Cancer Biology 2024Quote: ... cDNA for GFP and Luciferase were synthesized by GENEWIZ and cDNA for Gstm3 were synthesized from Genscript. Gateway sites were added to the cDNA through PCR and genes of interest were then used to replace the CcdB gene by Gateway recombination (Invitrogen #11789100 and #11791100) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and diluted 1:5000 HRP-conjugated goat anti-rabbit IgG (cat no. A00098, GenScript) were used as secondary antibodies ...
-
bioRxiv - Cancer Biology 2024Quote: ... Diluted 1:5000 horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG (cat no. A00160; GenScript) and diluted 1:5000 HRP-conjugated goat anti-rabbit IgG (cat no ...
-
bioRxiv - Cancer Biology 2024Quote: ... then samples were heated to 100°C for 5 min before being loaded into individual lanes of 4-12% SurePAGE™ Bis-Tris polyacrylamide gels (GenScipt, Piscataway, NJ, USA) and separated with electrophoresis within MES SDS running buffer (M00677; GenScript), using a Mini PREOTEAN 3 cell (525BR058974 ...
-
bioRxiv - Developmental Biology 2024Quote: ... A mixture of 100 ng/µL Cas9 protein (GenScript, New Jersey, USA) and 300 ng/µL gRNA for the injection into the eggs (per egg 2 nL was injected ...
-
bioRxiv - Developmental Biology 2024Quote: ... The CRISPRi library sgRNA oligos with Bsmb1 overhangs were synthesized by GenScript (Piscataway, NJ) and cloned into the lentiviral vector pXPR_050 by Golden Gate cloning following published protocols57 ...
-
bioRxiv - Cancer Biology 2024Quote: The pcDNA5/FRT/TO-Myc-FEN1 WT and E359K plasmids were synthesized by Genscript and include siResistance to FEN1 exon 2 siRNA GAUGCCUCUAUGAGCAUUUAU ...
-
bioRxiv - Cancer Biology 2024Quote: ... E84A and K577M plasmids were synthesized by Genscript and include siResistance to both WRN exon 9 siRNA GAGGGUUUCUAUCUUACUA and WRN exon17 siRNA AUACGUAACUCCAGAAUAC.
-
bioRxiv - Cell Biology 2024Quote: Heavy-labelled synthetic standards for all peptides mentioned in supplemental Table S2 were acquired from SpikeTides (JPT) or custom synthesis (GenScript) with the following chemical modifications ...
-
bioRxiv - Microbiology 2024Quote: ... using anti-His (mouse) primary antibody (GenScript) at a dilution of 1:3,000 ...
-
bioRxiv - Microbiology 2024Quote: ... and MW68945 were chemically synthesized (GenScript, USA) and cloned into the expression vector pcDNA3.3-TOPO (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... and synthetic fragments and genes encoding the fluorescent proteins from Genscript (Supplementary Table 2).
-
bioRxiv - Microbiology 2024Quote: ... A custom primary antibody for Imp1 (α-Imp1, Genscript), a commercial primary FLAG antibody (α-FLAG ...
-
bioRxiv - Microbiology 2024Quote: ... Membranes were then immunoblotted with custom-made α-Hcp2 (GenScript; polyclonal antibodies raised in rabbits against the peptides CGEGGKIEKGPEVGF or CVMTKPNREGSGADP ...
-
bioRxiv - Microbiology 2024Quote: Plasmids were synthesized and cloned by Genscript. The vector for all P ...
-
bioRxiv - Microbiology 2024Quote: A 17 amino acid mature SilCR peptide (DIFKLVIDHISMKARKK) was synthesized by Genscript. After reconstitution ...
-
bioRxiv - Cell Biology 2024Quote: Plasmid pHIPZ Tpo4 3xHA was obtained from GenScript, and constructed as follows ...
-
bioRxiv - Cell Biology 2024Quote: ... Chk2 was eluted from the beads by addition of PreScission Protease (Genscript Z02799) overnight rocking at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... the reaction products were loaded onto 4∼20% SDS-PAGE gels (GenScript Biotech, China), and then the signals were obtained by western blotting.
-
bioRxiv - Cell Biology 2024Quote: ... Di-thiolated peptides that are susceptible to metalloproteinase (MMP) cleavage (GCNSVPMSMRGGSNCG) and thiolated cell-adhesive peptides (GCGYGRGDSPG) were obtained from Genscript. HA hydrogels were fabricated by mixing 4 wt% norbornene-modified HA with 0.05 wt% photo-initiator lithium phenyl-2,4,6-trimethylbenzoylphosphinate (LAP ...
-
bioRxiv - Cell Biology 2024Quote: ... a synthetic gene fragment of VPS5 (ordered from GenScript) containing containing the following mutations - start codon of VAM10 sequence(M-to-I) ...
-
bioRxiv - Cell Biology 2024Quote: ... and then subjected to denaturation at 100 °C for 10 min after the addition of 4X protein loading buffer (GenScript Biotech, China). Then ...
-
bioRxiv - Cell Biology 2024Quote: ... using an eBlot™ L1 wet transfer (GenScript Biotech, China). Membranes were blocked and incubated with primary antibodies and secondary antibodies using eZwest Lite Automated Western Device (GenScript Biotech ...
-
bioRxiv - Cell Biology 2024Quote: ... Membranes were blocked and incubated with primary antibodies and secondary antibodies using eZwest Lite Automated Western Device (GenScript Biotech, China). Membranes were then incubated with Omni-ECL™Femto Light Chemiluminescence Kit (Epizyme ...
-
bioRxiv - Cell Biology 2024Quote: Wild-type and analog-sensitive Chk2 ORF sequences were cloned in the pGex6p-1 plasmid (Genscript, see plasmid construction section for details ...
-
bioRxiv - Bioengineering 2024Quote: ... with di-thiol peptide crosslinkers that were either broadly protease-degradable (KKCGGPQGIWGQGCKK, Genscript) or non-degradable (KKCGGDQGIAGFGCKK ...
-
bioRxiv - Bioengineering 2024Quote: ... or non-degradable (KKCGGDQGIAGFGCKK, Genscript). HA hydrogels had a total peptide crosslinker concentration of 0.838 mM for H80 ...
-
bioRxiv - Bioengineering 2024Quote: ... methacrylated HA was functionalized with cysteine-TMR (Genscript) at a concentration of 0.075 mM ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 mg/mL 3X-FLAG peptide (Genscript). Final purification was achieved by size exclusion chromatography (SEC ...
-
bioRxiv - Biochemistry 2024Quote: ... coli expressed saposins: We purchased from Genscript (Piscataway, NJ, USA) the codon-optimized SapB and SapD (UniProt P07602 ...
-
bioRxiv - Biochemistry 2024Quote: ... His-tagged Enterokinase (Z03004, Genscript) was added to the dialyzed ...