Labshake search
Citations for Takara Bio :
201 - 250 of 780 citations for Family With Sequence Similarity 46 Member B FAM46B Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: PDGF-IRES-Cre was generated by cloning human PDGF-B and Cre into pQXIX vector (Clontech) as previously described5 ...
-
bioRxiv - Cancer Biology 2019Quote: ... The WT or mutant sequences were then cloned into the lentiviral vector pLVX-Puro (Clontech, Mountain View, CA) for lentivirus production ...
-
bioRxiv - Plant Biology 2019Quote: ... Full-length cDNA of LcCHI2 sequence was obtained using a SMART™ RACE cDNA Amplification Kit (Clontech, USA) for 3’ RACE with the primers 5′-CCGACCAGTTCCAATGGGGCT-3′ and 5′-GGCCACGCGTCGACTAGTACTTTTTTTTTTTTTTTTT-3′.
-
bioRxiv - Microbiology 2019Quote: The coding sequence of DsRed was isolated from the pDsRed-monomer vector (Clontech/TaKaRa Bio, Ohtsu, Shiga, Japan) by digestion with the appropriate restriction enzymes ...
-
bioRxiv - Microbiology 2019Quote: The coding sequence of DsRed was isolated from the pDsRed-monomer vector (Clontech/TaKaRa Bio, Ohtsu, Shiga, Japan) by digestion with the appropriate restriction enzymes ...
-
bioRxiv - Molecular Biology 2022Quote: ... A 25 nt poly(A) sequence was inserted after the 3’ UTR using the In-Fusion (Takara Bio) method.
-
bioRxiv - Cell Biology 2022Quote: ... pNFLS2,51,55,66A-myc and pNFLS2,55,57,66D-myc constructs and then cloned these sequences into the pEGFP-N3 vector (Clontech/Takara Bio) between the EcoR1 and BamH1 restriction sites of the multiple cloning site ...
-
bioRxiv - Microbiology 2022Quote: ... CoV-229E sequences were obtained as gBlocks from IDT and subcloned into these plasmids using InFusion cloning (Takara).
-
bioRxiv - Plant Biology 2020Quote: ... Partial genomic sequences of CpPT1 were PCR amplified in these preparations using SapphireAmp Fast PCR Master Mix (Takara) and the primer pair citron_Fw and citron_Rv (Supplementary Table 8) ...
-
bioRxiv - Molecular Biology 2020Quote: ... we inserted the coding sequence between the SalI and BamHI restriction sites of the pAcGFP1-N1 plasmid (Takara). The total RNA was extracted from R ...
-
bioRxiv - Cancer Biology 2021Quote: ... the cDNA sequence of ERK5 isoforms were cloned into pLVX-Puro plasmid (Clontech Laboratories, Mountain View, CA, USA). Plasmids were sequenced to confirm the presence of correct cDNA sequences at the 3’-end of the CMV promoter (data not shown) ...
-
bioRxiv - Biochemistry 2021Quote: ... Coding sequence for RIIα was amplified from the library using primers Prkar2a_F & Prkar2a_R and inserted upstream of the IRES2 sequence in pIRES2-GFP (Clontech) using EcoRI and BamHI entry sites ...
-
bioRxiv - Microbiology 2021Quote: CFP/YFP plasmids were constructed by cloning the fluorescent protein coding sequence into pSTV28 (Takara Bio Europe SAS) with EcoRI/SalI restriction sites ...
-
bioRxiv - Genomics 2021Quote: The coding sequences for 23 tomato HSFs and 21 Arabidopsis HSFs were cloned into the pGADT7 vector (Clontech) as a prey (Supplementary table S8) ...
-
bioRxiv - Neuroscience 2022Quote: ... This sequence was cloned into the EcoRI-NotI sites of the CRISPRa plasmid using In-Fusion cloning (Takara). All guide sequences and their genomic locations are listed in Supplementary Table S1 and PCR primers used to verify editing are listed in Supplementary Table S2.
-
bioRxiv - Microbiology 2022Quote: ... The coding sequence of enhanced green fluorescent protein (eGFP) was amplified from plasmid eGFP-C1 (6084-1, Clontech) using primers eGFPN-F/eGFPN-R ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sequence-verified mutated ORFs were inserted into the pLNCX2 retroviral vector (Clontech Takara, Mountain View CA 94043, USA). The siRNA target sequences were used to generate 64mer DNA oligonucleotides in accordance with the Oligoengine template design (www.oligoengine.com) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sequence-verified mutated ORFs were inserted into the pLNCX2 retroviral vector (Clontech Takara, Mountain View CA 94043, USA). The siRNA target sequences were used to generate 64mer DNA oligonucleotides in accordance with the Oligoengine template design (www.oligoengine.com) ...
-
bioRxiv - Physiology 2022Quote: ... The insulin-like growth factor 1 (IGF1) coding sequence was PCR amplified (CloneAmp, Takara Bio; Cat. No. 639298) from cDNA generated from a rat gastrocnemius muscle ...
-
bioRxiv - Physiology 2022Quote: The coding sequence of PIK3CA was then cloned PIK3CA into the pcDNA3.4 vector through in-fusion cloning (Clontech) as an untagged protein or with an N-terminal polyhistidine tag ...
-
bioRxiv - Cell Biology 2023Quote: ... The cDNA sequences of CHIKV 6K and TF (Supplementary Figure S1) were cloned in the pEGFPC1 vector (Clontech) to generate fusion proteins tagged with the Enhanced Green Fluorescent Protein (EGFP ...
-
bioRxiv - Microbiology 2023Quote: The 16S rRNA gene sequences were amplified by PCR using LA Taq polymerase (TaKaRa-Bio, Inc., Shiga, Japan) using the primers Uni530F and Uni907R65 ...
-
bioRxiv - Plant Biology 2023Quote: ... The double-strand oligonucleotides containing the target sequences were synthesized and cloned into pMpGE_En01 or pMpGE_En03 using In-Fusion HD cloning kit (TaKaRa) and BsaI restriction sites in pMpGE_En03 ...
-
bioRxiv - Immunology 2023Quote: ... linearized BF520 sequence was gel purified using NucleoSpin Gel and PCR Clean-up kit (Takara, Cat. No. 740609.5) and then purified using Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Cell Biology 2023Quote: ... Full-length human CLUH and mouse Cluh coding sequences cDNA were cloned in pcDNA3 and pmCherry-N1 (Clontech), respectively ...
-
bioRxiv - Microbiology 2024Quote: ... linearized GPC sequence was gel purified using NucleoSpin Gel and PCR Clean-up kit (Takara, Cat. No. 740609.5) and then purified using Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Immunology 2022Quote: ... Bulk TCR sequencing was performed using the SMARTer® Mouse TCR a/b Profiling Kit (Takara Bio). Libraries were sequenced using the 600-cycle MiSeq Reagent Kit v3 (Illumina ...
-
bioRxiv - Neuroscience 2022Quote: ... a sequence region of 5,000 bp between SnaBI and AgeI restriction sites was amplified using the HiFi amplification kit (Clontech, Takara Bio Europe ...
-
bioRxiv - Molecular Biology 2021Quote: ... were used to amplify the full-length coding sequences CDS amplified with Tks Gflex™ DNA Polymerase (TaKaRa, Japan) according to manufacturer’s directions with an annealing temperature of 56.4°C ...
-
bioRxiv - Molecular Biology 2019Quote: A DNA fragment containing N-terminal GST tag and TEV protease recognition sequence was inserted into pCold I (Takara), followed by the insertion of a DNA fragment containing C-terminal 2×HA tag by NEBuilder HiFi DNA Assembly Master Mix (NEB) ...
-
bioRxiv - Cell Biology 2019Quote: ... these sequences were amplified by PCR from plasmids described above and inserted into SmaI-digested pLVX-puro vector (Clontech) by Gibson Assembly ...
-
bioRxiv - Cell Biology 2019Quote: The rescued mEFs (expressing vimentin) were created by PCR amplification of the vimentin coding sequence using CloneAmp polymerase (Clontech) from pcDNA4- vimentin (provided by J ...
-
bioRxiv - Molecular Biology 2019Quote: ... and the DNA fragments around the target sequences were amplified with the following primers using PrimeSTAR Max (TaKaRa, Japan).
-
bioRxiv - Genetics 2019Quote: ... This sequence was cloned into the EcoRI-NotI sites of the modified plasmid 61591 using In-Fusion cloning (Takara). The guide sequence ‘FOP1’ (AAAAGGTGAGGTCACGAGGCC ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR product of the assembled sequence was purified with a DNA Fragment Purification Kit (Takara, Dalian of China) and eluted with ddH2O ...
-
bioRxiv - Cell Biology 2021Quote: ... A part of the cDNA sequence of Seipin and GAPDH was amplified using PrimeSTAR GXL DNA polymerase (Takara Bio) and pairs of primers ...
-
bioRxiv - Cell Biology 2022Quote: ... pNFLS2,51,55,66A-myc and pNFLS2,55,57,66D-myc constructs and then cloned these sequences into the pEGFP-N3 vector (Clontech/Takara Bio) between the EcoR1 and BamH1 restriction sites of the multiple cloning site ...
-
bioRxiv - Immunology 2022Quote: The sequence of anti-IFNγ was cloned from XMG1.2 hybridoma (ATCC) using SMARTer RACE 5’/3’ kit (Takara Bio). The 6xHis tagged anti-Dsg ...
-
bioRxiv - Biochemistry 2019Quote: ... Both PCR-amplified sequences were cloned into a pLVX-Puro vector (Clonetech) using Gibson assembly (In-Fusion cloning, Takara), to form GCP2_G5A_TEV_G5A_mTagBFP_G5A_BAP ...
-
bioRxiv - Cell Biology 2021Quote: ... red fluorescent protein fused with the mitochondrial targeting sequence from cytochrome c oxidase subunit VIII (Clontech, Mountain View, CA) using Lipofectamine 2000 (Life Technologies ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and ii) because the relevant primer sequence is proprietary (both confirmed by Takara EU tech support in November 2020), so that we initially did not have access to its sequence ...
-
bioRxiv - Genomics 2019Quote: ... Amplified fragments containing 145 bp sequence were then cloned into pGL4.23 vector using In-Fusion HD Cloning kit (Clontech). The resulting constructs were co-transfected with renilla luciferase into melanoma cell lines (UACC903 and UACC502 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Human eRF1 coding sequence was cloned into the XhoI and HindIII sites of the pλN-HA-C1 vector (Clontech). The pλN-HA-C1-eRF1 plasmid was then used to generate the pλN-HA-C1-eRF1AAQ (G183A G184A ...
-
bioRxiv - Neuroscience 2021Quote: ... 5’ UTR and EGFPd2 sequences were cloned in the multiple cloning site of pTet-One vector (Takara-Clontech, 634301). DG NSC Droshafl/fl cells were brought in suspension by incubating with 0.25% trypsin (Gibco #15090 ...
-
bioRxiv - Neuroscience 2021Quote: ... 5’ UTR and EGFPd2 sequences were cloned in the multiple cloning site of pTet-One vector (Takara-Clontech, 634301). DG NSC Droshafl/fl cells were brought in suspension by incubating with 0.25% trypsin (Gibco #15090 ...
-
bioRxiv - Neuroscience 2022Quote: ... This sequence was cloned into the EcoRI-NotI sites of the modified plasmid 61591 using In-Fusion cloning (Takara). The ‘empty vector’ control contained CMV-promoter driven dSaCas9-KRAB but no guide sequences ...
-
bioRxiv - Microbiology 2022Quote: Amplified spike sequence was first gel-purified using NucleoSpin Gel and PCR Clean-up kit (Takara, Cat. No. 740609.5) and then further purified using Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Cell Biology 2023Quote: ... 2xmCh-KIF5C in pcDNA3.1 was cloned by inserting in-frame KIF5C full length from EGFP-KIF5C (a gift from Anthony Brown) 2xmCh sequence from KIF5C(1-560)-2xmCh-EF(C) into pcDNA3.1 using InFusion Cloning kit (Takara). EGFP-Rab7A (Addgene #28047 ...
-
bioRxiv - Plant Biology 2022Quote: ... The coding sequences of PWO2 and the fragment of PWO3 were cloned in the pGBKT7 and pGADT7 vectors (Clontech), passing through pDONR221 (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: AAV transfer plasmids were constructed by removing all the sequences between the ITRs of the pAAV-CMV vector (TaKaRa) and inserting the Mhck7 promoter ...