Labshake search
Citations for Takara Bio :
151 - 200 of 780 citations for Family With Sequence Similarity 46 Member B FAM46B Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... DYRK3 sequence was inserted using the In-Fusion HD cloning kit (Takara Bio USA, Inc), to replace the DCP1a sequence with DYRK3 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Individual ASO-targeted sequences were mutated by inverse PCR with PrimeSTAR GXL DNA polymerase (TaKaRa) and specific primer sets (Supplementary Dataset 5) ...
-
bioRxiv - Genomics 2022Quote: ... a gift from the Darzacq/Tijan Lab) sequences were inserted using InFusion cloning (Takara Bio). This cloning strategy inserted a MluI restriction digest site 3’ of the CD19 stop codon and removed the MluI restriction digest site 3’ of the EGFP stop codon ...
-
bioRxiv - Evolutionary Biology 2022Quote: CDS sequence coding protein BmMETTL3(204-329) was cloned into the Pcold vector (TaKaRa, China). Primers were listed in Table S1 ...
-
bioRxiv - Plant Biology 2022Quote: The coding sequence (CDS) of SAUR30 was cloned using Prime STAR MAX polymerase mix (TaKaRa) and the gene-specific primers shown in Supplemental Table S1 ...
-
bioRxiv - Molecular Biology 2022Quote: The respective sequences of the proteins were cloned into pGBKT7 and pGADT7 vectors from Clontech which harbor either the DNA binding domain or activation domain at the N-termini ...
-
bioRxiv - Immunology 2022Quote: ... the same sequences were cloned into the pQCXIP vector backbone (Takara Bio, Mountain View, CA) with a C-terminal Myc tag ...
-
bioRxiv - Microbiology 2023Quote: ... sequence fragments were amplified from the complete hnRNPM cDNA using PrimeSTAR Max DNA Polymerase (TaKaRa) with primer sets no ...
-
bioRxiv - Plant Biology 2023Quote: Coding sequences were cloned in the GAL4 system Gateway® vectors (pGADT7 and pGBKT7; Clontech) using primers listed in Dataset S1 ...
-
bioRxiv - Microbiology 2023Quote: ... Amplified DNA encoding the sequence for H2A.X was ligated in frame with pEGFP-C1 (Clontech) at the BglII and SalI restriction sites.
-
bioRxiv - Cell Biology 2019Quote: ... Mouse Ca14 coding sequence was amplified from mouse B16 cDNA and cloned in mcherryN1 vector (Clontech) in KpnI/HindIII site ...
-
bioRxiv - Molecular Biology 2019Quote: ... GFI1B-BirA*:HA forms were expressed from PCR amplified sequences subcloned into pLVX-Tight-Puro (Clontech) with Not1/Mlu1 for doxycycline inducible expression with the Tet-On Advanced (Clontech ...
-
bioRxiv - Cell Biology 2021Quote: ... The nucleotide sequence encoding for human CyPD was obtained from a Human cDNA placenta library (Clontech) by PCR ...
-
bioRxiv - Neuroscience 2021Quote: ... intron 20 and exon 21 sequence was synthesised and cloned into a pIRES-EGFP vector (Clontech) by BioCat ...
-
bioRxiv - Molecular Biology 2022Quote: ... EBIV M/L segment-specific sequences were amplified by PCR including Universal Primer A Mix (Takara), Gene-Specific Primers (GSPs ...
-
bioRxiv - Cell Biology 2022Quote: ... TurboGFP was exchanged for eGFP by amplifying the eGFP sequence by PCR from peGFP-N1 (Clontech) using the following primers to introduce AgeI and NotI restriction sites ...
-
bioRxiv - Genetics 2022Quote: Full length wild-type or mutant BRC-1 sequences were cloned into plasmid pBridge (Takara Bio), transformed into yeast strain Y2HGold (Takara Bio ...
-
bioRxiv - Neuroscience 2022Quote: ... Target sequences were amplified by 18–30 cycles of PCR using Ex-Taq™ (Takara Bio). For semiquantitative PCR ...
-
bioRxiv - Cell Biology 2023Quote: ... a DNA cassette containing the miRNA sequence was subcloned and inserted into pEBFP-C1 (Takara Bio) and pmCherry-C1 (Takara Bio ...
-
bioRxiv - Microbiology 2023Quote: ... fus3::nyfp and cyfp::gal83 sequences were constructed on the pMD18-T (D101A, Takara, Dalian, China) plasmid with ClonExpress II One Step Cloning Kit (C112-01 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... protein-coding sequences for Tluc were replaced with corresponding fragments through In-Fusion cloning (Takara; 638948) or restriction cloning strategies ...
-
bioRxiv - Biochemistry 2024Quote: The SUGCT coding sequence was amplified by PCR by using PrimeStar GXL polymerase (Takara Bio Inc) using the following primers (start and stop codon in bold) ...
-
bioRxiv - Plant Biology 2023Quote: ... Site-directed mutagenesis at the CESA1 sequence was performed using the infusion cloning kit from Takara Bio ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV was titrated using quantitative PCR (qPCR) with primers for the ITR sequence (TaKaRa Bio Inc).
-
bioRxiv - Plant Biology 2024Quote: ... The SKI2 cDNA sequence was amplified from wild type cDNA using CloneAmp HiFi PCR Premix (Takara) and cloned into the pPZP212 binary vector ...
-
bioRxiv - Plant Biology 2024Quote: ... The ARF sequences within pDONR207 were then recombined into the pGAD-T7 and pGBK-T7 (Clontech) expression vectors by LR clonase reactions ...
-
bioRxiv - Immunology 2024Quote: ... The TCR sequences were then isolated using 5’RACE (SMARTer RACE cDNA Amplification Kit, Takara Bio), followed by PCR amplification with primers designed to be complementary to TRAC (GTTGCTCCAGGCAATGGCCCCATTGCTC ...
-
bioRxiv - Immunology 2024Quote: ... Plasmid sequences confirmed by Sanger sequencing (Quintara Biosciences) were transformed into Stellar Competent Cells (Takara Bio) and purified using the NucleoBond Xtra Midi endotoxin-free midi-prep kit (Takara Bio) ...
-
bioRxiv - Biophysics 2022Quote: ... This plasmid expresses the PR isoform-B under a tetracycline controllable promoter (TetOff system, Clontech). To perform the SPT experiments ...
-
bioRxiv - Cancer Biology 2021Quote: ... Virus transduction was performed using RetroNectin® Recombinant Human Fibronectin Fragment (Takara, cat.no. T100A/B) according to the manufacturer’s instructions (with centrifugation) ...
-
bioRxiv - Biophysics 2022Quote: ... This plasmid expresses the PR isoform-B under a tetracycline controllable promoter (TetOff system, Clontech). To perform the SPT experiments ...
-
bioRxiv - Cell Biology 2023Quote: ... hygromycin B (300 µg/ml) and 10% tetracycline free fetal bovine serum (Takara Bio, USA) in a humidified incubator at 37°C in 5% CO2 in 6-well plates ...
-
bioRxiv - Cancer Biology 2023Quote: ... mRNA was utilized with the SMARTer Human TCR a/b Profiling Kit v2 (Takara, USA). The resulting libraries were sequenced for paired-end reads of 2×250 bp on an Illumina system at a sequencing depth of 7.5X.
-
bioRxiv - Neuroscience 2021Quote: The sgRNA sequences were amplified using Guide-it™ CRISPR Genome-Wide Library PCR Kit (Takara, 632651) and subjected to the high-throughput amplicon sequencing on NextSeq500 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The 3xFlag sequence was then ligated into the digested eGFP-Usp9x plasmid (Takara DNA ligation kit #6023).
-
bioRxiv - Molecular Biology 2020Quote: ... and cloned downstream of a sequence encoding the CD8 signal peptide (MALPVTALLLPLALLLHAA) in the vector pIRESpuro3 (Clontech). BC-deltaSTP-GPR56 was from Lei Xu (Addgene ...
-
bioRxiv - Molecular Biology 2019Quote: ... H1R DRY and AT1AR DRY sequence were cloned into pN1-mCherry and pN1-p2A-mCherry vectors (Clontech). Plasmids encoding Rnßarr1-mYFP (plasmid #36916 ...
-
bioRxiv - Microbiology 2020Quote: ... The synthetic sequence was cloned into inversely amplified pSW002-Pc PCR product by infusion cloning (Takara, Z9633N). pSW002-Pc was a gift from Rosemarie Wilton (Addgene plasmid # 108234 ...
-
bioRxiv - Neuroscience 2020Quote: ... This sequence was inserted into a donor plasmid (pCRII-TOPO) using In-Fusion HD cloning (Takara – 639649). For the Cas9 plasmid ...
-
bioRxiv - Microbiology 2021Quote: ... The sequence encoding amino acids 2-1273 were cloned into a shuttle plasmid following InFusion cloning (Clontech). The shuttle plasmid encodes a modified human cytomegalovirus major immediate early promoter (IE CMV ...
-
bioRxiv - Pathology 2020Quote: ... the coding sequence of CSTB was cloned into an EGFP expression vector (pEGFP-N3, Clontech, GenBank: U57609). The empty EGFP vector was used as a control ...
-
bioRxiv - Molecular Biology 2019Quote: ... Sequences of the PCR amplicons were determined by commercial Sanger-sequencing service (Takara Bio Inc. Kusatsu, Japan). Sequences of all reference haplotypes are listed in Table S1 and deposited to the DNA database of Japan (Accession number ...
-
bioRxiv - Neuroscience 2020Quote: ... The APP-mCherry plasmid was generated by introducing the APP751 sequence in the pmCherry-N1 vector (Clontech) at the XmaI/AgeI restriction site ...
-
bioRxiv - Genetics 2021Quote: The coding sequence of the MAR was inserted into the Gal4 DNA-binding domain vector pGBKT7 (Clontech); the coding sequences for full length Nup60 and Nup60(188-388 ...
-
bioRxiv - Immunology 2022Quote: ... Retrovirus vectors carrying shRNA sequences were constructed by inserting annealed oligonucleotides into a pSIN-siU6 vector (Takara) between BamHI and ClaI sites ...
-
bioRxiv - Molecular Biology 2023Quote: ... cDNAs encoding for sequences of proteins of interest were amplified and inserted into pEGFP-N1 vector (Clontech). Each DNA construct was checked by conventional Sanger sequencing of purified plasmid.
-
bioRxiv - Microbiology 2023Quote: ... pcDNA-EGFP-P2A-stop was constructed by amplifying the EGFP and P2A sequences from pEGFP-C1 (Clontech) using the primers shown in S-Table 3 and cloning it into the BamHI and EcoRI sites of pcDNA3.1(+ ...
-
bioRxiv - Biochemistry 2023Quote: ... For amplification of DNA sequences for cloning and NGS the PrimeSTAR Max DNA polymerase (Takara Bio Inc.) and for colony PCRs the OneTaq Quick-Load Master Mix Polymerase was used (NEB) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and TCR beta chain libraries were generated using SMARTer Mouse TCR a/b Profiling Kit (Clontech). Samples were pooled to a final pool concentration of 4 nM and diluted to a final concentration of 13.5 pM ...
-
bioRxiv - Cell Biology 2021Quote: ... pBos-CENP-B-GFP was constructed by replacing the H2B fragment in pBos-H2B-GFP (Clontech) with the KpnI/BamHI-digested PCR fragments encoding the centromere-targeting domain (residues 1-163 ...