Labshake search
Citations for Takara Bio :
1 - 50 of 780 citations for Family With Sequence Similarity 46 Member B FAM46B Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... and the BrSCR-46 cassette was similarly cloned into the plasmid containing the BrSRK-46 chimera by InFusion cloning (TAKARA Bio). Similarly ...
-
bioRxiv - Cell Biology 2021Quote: ... the coding sequences of human Pcnt B and Pcnt S were subcloned into peGFP-N1 (Takara Clontech) using the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs ...
-
bioRxiv - Cell Biology 2021Quote: ... the coding sequences of human Pcnt B and Pcnt S were subcloned into peGFP-N1 (Takara Clontech) using the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs ...
-
bioRxiv - Developmental Biology 2021Quote: ... was inserted in a Tol2 vector containing the hsp70l:xxxp2a-TFP sequence (kind gift from Prof. B. Martin, Stony Brooks University, NY) by In Fusion (Clontech) cloning ...
-
bioRxiv - Developmental Biology 2021Quote: ... AP20187 (B/B) compound (Takara Bioscience) was injected into the dorsal aorta through a small window made in the ventral egg ...
-
bioRxiv - Biophysics 2022Quote: ... B/B homodimeriser (AP20187, Takara Bio), dibenzocyclooctyne-PEG4-maleimide (760676 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... B/B dimerizer (AP20187 ligand; TaKaRa 635058) was added to a final concentration of 500 nM in the well ...
-
bioRxiv - Immunology 2022Quote: ... B/B homodimerizer (Takara Bio, Cat#635058), b-estradiol (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... 500 nM B/B Homodimerizer (Takara, #635058) was also added ...
-
bioRxiv - Neuroscience 2023Quote: B/B homodimerizer was purchased from Takara USA lnc ...
-
bioRxiv - Pathology 2020Quote: AP21087 ((B/B homodimerizer, Takara Bio, CA, USA) was administered by intra-peritoneal (ip ...
-
bioRxiv - Cell Biology 2019Quote: ... AP20187 (B/B Homodimerizer) was purchased from Takara. The recombinant Anti-M1 Spastin rabbit monoclonal antibody ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 500 nM of the B/B dimerizer (TaKaRa 635058) was added 2 hours before the start of the assay (or an Ethanol vehicle control was added) ...
-
bioRxiv - Immunology 2019Quote: ... B/B Homodimerizer (Takara, 635059, equivalent to AP-20187), disuccinimidyl suberate (DSS ...
-
bioRxiv - Neuroscience 2022Quote: ... AP20187 (B/B) (Clontech, Saint-Germain-en-Laye France) was added 4 h post-transfection overnight.
-
bioRxiv - Developmental Biology 2020Quote: ... 1.0 μl of 25mM B/B (in DMSO) (AP20187, Takara) was added to 50ul of PGCs (3,000 PGCs/μl ...
-
bioRxiv - Genetics 2020Quote: ... 1.0 ul of 25mM B/B (in DMSO) (Takara Bio) was added to 50ul PGC suspension before injection and subsequently 50 μl 300ul P/S (containing 30ul of 0.5mM B/B drug ...
-
bioRxiv - Neuroscience 2021Quote: The 5’UTR promoter region of mouse L1Spa belonging to LINE-1 Tf family was amplified with the primers (Fw; AATGGGCAGAGCTCGTTTAG, Rv: CTGGTAATCTCTGGAGTTAG) and Takara LA Taq polymerase with GC buffer (Takara Bio) using pTN201 plasmid (a kind gift from Dr ...
-
bioRxiv - Neuroscience 2023Quote: ... and then the coding sequence of eGFP (sequences extracted from pIRES2-EGFP, Clontech). Hβ4StrepTagII-nAChR-IRES-mTurquoise ...
-
bioRxiv - Biochemistry 2021Quote: ... After 16 hours of incubation with B/B homodimerizer (Takara Bio, 635059) at various concentrations ...
-
bioRxiv - Immunology 2022Quote: ... cells were stimulated with indicated concentrations of B/B homodimerizer (Takara Bio) for 15 h ...
-
bioRxiv - Neuroscience 2023Quote: ... the designed drug AP20187 (AP; B/B Homodimerizer purchased from Takara #635058) was first prepared according to manufacturer’s directions in 100% ethanol ...
-
bioRxiv - Microbiology 2019Quote: ... and hygromycin B (Clontech) were added to the medium ...
-
bioRxiv - Cell Biology 2021Quote: ... Aggregates were formed by addition of 500nM rapalog2 (Takara, B/B homodimerizer #635059) for 1 h ...
-
bioRxiv - Biophysics 2023Quote: ... Pyroptosis was induced by addition of 500nM B/B-Homodimerizer (Takara Bio, AP20187) at 37°C and 5% CO2 ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were exchanged with fresh media containing B/B homodimerizer (500nM) (Takara Bio, #635059) and/or Baf-A1 (100nM ...
-
bioRxiv - Microbiology 2023Quote: ... The Rluc sequence was then replaced by the YFP sequence of pEYFP-N1 (Clontech, Mountainview, CA) by insertion into the NcoI-NotI sites ...
-
bioRxiv - Genetics 2019Quote: ... The eGFP coding sequence (Clontech Inc.) was amplified with the primers F-eGFP-SpeI and R-eGFP-XhoI to generate the corresponding enzyme sites on the eGFP coding sequence ...
-
bioRxiv - Microbiology 2019Quote: The dual-luciferase assay using an NF-□B–dependent firefly luciferase (pNF-□B-Luc; Clontech) and a Renilla luciferase driven by the thymidine kinase promoter (pRLTK ...
-
bioRxiv - Cell Biology 2023Quote: ... by replacing EGFP-coding sequences with mCherry-coding sequences using In-Fusion® HD Cloning Kit (Clontech).
-
bioRxiv - Physiology 2022Quote: ... The primer sequences were obtained from Takara and listed in supplementary Table 1 ...
-
bioRxiv - Cell Biology 2024Quote: ... The mCherry sequence from pmCherry-C1 (Clontech) was amplified to introduce flanking NheI sites using the following primers:
-
bioRxiv - Cancer Biology 2021Quote: ... including a puromycin resistance cassette and a tet-responsive element for expression of shRNAs was established according to a publicly available protocol (46) using In-Fusion HD Cloning Kit (Clontech) (Supplementary Table 3) ...
-
bioRxiv - Microbiology 2022Quote: ... These two amplified fragments were inserted into the pBh-EPS vector [46] at the PstI site using the In-FusionHD Cloning Kit (Takara). The resultant plasmid and Bsu36I-digested BmNPV-abb genome DNA [47] were cotransfected into BmN-4 cells using FuGeneHD (Promega) ...
-
bioRxiv - Plant Biology 2019Quote: Full-length PC2 gene and its orthologs sequences with PR1 signal peptide sequence amplified from cDNA of various species using high-fidelity PrimeSTAR HS DNA Polymerase (Takara), primers pairs and restriction enzymes (Supplementary Table 4 ...
-
bioRxiv - Biochemistry 2020Quote: ... pSUPER-hygro was derived from the pSUPER-puro (Oligoengine) by replacing a puromycin resistance gene sequence with a hygromycin resistance gene sequence from pMSCV-hygro vector (Clontech), and it was used for expressing shRNA in NIH3T3 fibroblasts by retroviral infection ...
-
bioRxiv - Cell Biology 2023Quote: ... pLVX-DsRed-Monomer-N1–hVMP1 was obtained by inserting the human VMP1 sequence (NCBI reference sequence: NM_030938.5) into pLVX-DsRed-Monomer-N1 (CLONTECH cat. 632152). pLenti–VMP1–GFP was obtained by cloning the VMP1 sequence (NCBI reference sequence ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 2019) upstream of an egfp coding sequence and an SV40 polyadenylation sequence using In-Fusion Snap Assembly master mixes (Takara). To prepare the injection mixtures ...
-
bioRxiv - Bioengineering 2023Quote: GA-MatryoshCaMP6s was constructed by replacement of the coding sequence of LSSmOrange in GO-MatryoshCaMP6s with the LSSmApple coding sequence by In-Fusion cloning (Takara) following manufacturer recommendations ...
-
bioRxiv - Microbiology 2022Quote: ... the coding sequence was cloned by InFusion (Clontech) in the plasmid pMT85 under the control of the promoter PTufA (42) ...
-
bioRxiv - Microbiology 2022Quote: ... or the mEos3.2 coding sequence using InFusion (Clontech). Plasmids carrying the cassettes were checked by Sanger sequencing (Genewiz) ...
-
bioRxiv - Cell Biology 2023Quote: ... the calreticulin signal sequence of pDsRed2-ER (Clontech) was removed by cleavage with NheI and BglII ...
-
bioRxiv - Bioengineering 2023Quote: ... The coding sequences for ZsGreen (pIRES2-ZsGreen1, Takara) and Luciferase (luc2 ...
-
Heat Shock Factor 1 (HSF1) as a new tethering factor for ESR1 supporting its action in breast cancerbioRxiv - Cancer Biology 2021Quote: The shRNA target sequence for human HSF1 (NM_005526.4) was selected using the RNAi Target Sequence Selector (Clontech, Mountain View, CA, USA). The target sequences were ...
-
bioRxiv - Biochemistry 2022Quote: The expression plasmid for N-terminal 6×His-tagged mCherry-Nter was constructed by inserting the sequence encoding DmAgo2 Nter (residues 1–398) amplified from the native DmAgo2 sequence into pCold I (TAKARA Bio) using the InFusion HD cloning kit (Clontech) ...
-
bioRxiv - Cell Biology 2023Quote: The plasmid pEGFP-N1–VMP1 was obtained by inserting the human VMP1 sequence (NCBI reference sequence: NM_030938.5) into pEGFP-N1 (CLONTECH cat. #6085-1). The plasmid pcDNA4-B–hVMP1–V5/His was obtained by inserting the human VMP1 sequence (NM_030938.5 ...
-
bioRxiv - Bioengineering 2022Quote: The transfer vector pABpaR2pX was constructed by inserting a DsRed2 reporter gene driven by pag promoter(46) (p-pag) into the EcoRV restriction enzyme site of pBacPAK8 (Clontech Laboratories, Inc.). cDNAs encoding HA7 and NA9 were synthesized by GenScript ...
-
bioRxiv - Immunology 2023Quote: The medium from transfected HEK293T cells was replaced with Opti-MEM containing 1 μM of B/B Homodimeriser (AP20187; Clontech) and incubated for 30 min ...
-
bioRxiv - Molecular Biology 2019Quote: The 5’ flanking sequence of the insertion sequence was obtained by the Genome Walking Kit according to the manufacturer instructions (TaKaRa, Dalian, China). The random primers were provided by the Genome Walking Kit and the specific primers designed based on theoretical insertion sequences (first round zsp1 ...
-
bioRxiv - Genetics 2020Quote: 5’ leader repeat lines were generated by cloning the same 28 repeat sequence described above with approximately 30nt on either side of intronic sequence into the 5’UTR of pEGFP-N1 (Takara Bio USA) in the 0+ reading frame ...