Labshake search
Citations for Takara Bio :
4601 - 4650 of 5037 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2020Quote: ... we changed the CaMAL2 promoter to the ScGAL1 promoter using an In-Fusion kit (Takara Bio USA Inc., Mountain View, CA, USA) to generate pSFS4A plasmid ...
-
bioRxiv - Neuroscience 2020Quote: ... RT-PCR analysis was performed using the TB Green® Premix Ex Taq™ Tli RNaseH Plus kit (TAKARA, Mountain View, CA). The gene-specific primer sequences were as follows ...
-
bioRxiv - Genomics 2021Quote: ... Purified RNA samples were diluted to 1 μg/μL and pooled to perform cDNA synthesis by utilizing PrimerScript first strand cDNA synthesis kit (Cat. no. 6110A, Takara Bio, Japan), following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2020Quote: ... To determine the 5’ and 3’ UTR of the sds3 gene 5’ and 3’ Rapid amplification of cDNA ends (RACE) was performed using the SMARTer® RACE 5’/3’ Kit (Takara Bio) on RNA isolated using Trizol (Life Technologies ...
-
bioRxiv - Genetics 2020Quote: ... First-round reverse transcription PCR (RT-PCR) was conducted by using PrimeScript One Step RT-PCR Kit Ver.2 (TaKaRa, Dalian, China). A 10 μL reaction mixture contained 5 μL of 2 × 1 Step Buffer ...
-
bioRxiv - Genetics 2020Quote: ... The 5’ and 3’ end of the viral genome was amplified by rapid amplification of cDNA ends by using the 5’ and 3’ Smarter RACE kit (TaKaRa, Dalian, China).
-
bioRxiv - Cell Biology 2020Quote: ... Two micrograms of RNA were reverse transcribed into cDNA using a PrimeScript™ First-Strand cDNA Synthesis Kit (TaKaRa, Shiga, Japan; 6110B). Real-time quantitative PCR (qPCR ...
-
bioRxiv - Immunology 2021Quote: Retroviral SARS-CoV-2 Spike pseudovirus were generated in 293T cells by co-transfecting expression plasmids containing SARS-CoV-2 Spike and MLV gag/pol and luciferase vectors using Calphos transfection kit (Takara Bio, USA) as described [20] ...
-
bioRxiv - Zoology 2021Quote: ... 1.0 mg RNA was reverse-transcribed into first-strand cDNA using the PrimeScriptTMRT reagent Kit with the gDNA Eraser following the protocol of manufacturer (Takara, Dalian, China). The reverse transcriptional procedure included the following ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The C-terminus of Rtl5 was fused with mCherry by means of a cloning enzyme (In-Fusion® HD Cloning Kit, Takara Bio) and it was inserted into a pGEM T Easy vector (Promega) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The Rdl PCR-product was subcloned into the transcription vector pTB-207 38 using the In-Fusion® HD Cloning Kit (Clontech™) and cRNAs were synthesized with the T7 mMessage mMachine kit (Ambion™) ...
-
bioRxiv - Pathology 2021Quote: ... The number of SARS-COV-2 copies were quantified using Direct One-Step RT-qPCR Mix for SARS-CoV-2 kit (Takara Bio Inc.).
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Site-directed mutagenesis in GC-A and GC-B and construction of chimeric receptors were performed through use of the In-Fusion HD plus cloning kit (Takara Bio Inc.). The primers used are listed in Supplementary Table 1 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Hmx1 putative enhancer elements were amplified by PCR from total genomic DNA using the LA Taq PCR kit v2.1 (TaKaRa, Mountain View, CA) and the following primers ...
-
bioRxiv - Cancer Biology 2020Quote: ... Purified RNA samples were reverse-transcribed into cDNA using the PrimeScript™ RT Reagent Kit with gDNA Eraser (RR047A, TaKaRa, Tokyo, Japan).
-
bioRxiv - Cancer Biology 2021Quote: ... according to instructions provided by the manufacturer and 2μg aliquots were reversed transcribed cDNAs using PrimeScript™ RT-PCR Kit (Takara, Dalian, China). After ...
-
bioRxiv - Immunology 2020Quote: ... Viral particle counts were determined by sodium dodecyl sulfate disruption and spectrophotometry at 260 and 280 nm and viral titers were determined using the Adeno-X™ Rapid Titer Kit (Takara Bio). The constructs created included:
-
bioRxiv - Microbiology 2020Quote: ... the target genes with or without glycosite mutation were cloned into the pTOR::FLAG vector using the In-fusion HD Cloning kit (Clontech, Beijing, China) (Table S1) ...
-
bioRxiv - Immunology 2020Quote: ... the reverse transcription (RT) reaction was performed in a two-step method following the PrimeScript™ II Reverse Transcriptase kit protocol (Takara, Japan). For the first step ...
-
bioRxiv - Immunology 2021Quote: ... TM cells were directly sorted into 1X lysis buffer and cDNA was synthesized and amplified directly from intact cells using SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara Bio USA) according to the manufacturer protocol ...
-
bioRxiv - Immunology 2021Quote: ... SMART-Seq v4 Ultra Low Input Kit for Sequencing was used for full-length cDNA synthesis and amplification (Clontech, Mountain View, CA), and Illumina Nextera XT library was used for sequencing library preparation ...
-
bioRxiv - Genomics 2021Quote: Paired-end RNA-seq libraries were constructed from >747 pg of RNA using the SMART-Seq v4 ULTRA Low Input RNA Kit for Sequencing (Takara, cat. 634891) and NexteraXT kits (Illumina ...
-
bioRxiv - Neuroscience 2021Quote: ... encoding murine preproSST transgene fused with GFP via T2A self-cleavage spacer sequence was prepared by AAVpro purification kit (TaKaRa Bio, Japan) and bilaterally injected into PFC (AP +1.9 mm ...
-
bioRxiv - Bioengineering 2020Quote: ... cDNA was synthesized using a mix of random hexamers – oligo d(T) primers and PrimerScript reverse transcriptase enzyme (Takara bio inc. Kit), again following the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Neurons were transfected with GCaMP6 or NEMO-encoding plasmids at 7 to 9 days after plating using a calcium phosphate transfection kit (Takara Bio Inc).
-
bioRxiv - Cell Biology 2023Quote: ... A total of 1-2 μg RNA was reverse transcribed with random hexamers using PrimeScript 1st strand cDNA synthesis kit (Takara Bio, Japan) per the manufacturer’s protocol on Verti 96 well thermocycler (Thermo Scientific ...
-
bioRxiv - Plant Biology 2022Quote: ... The qRT-PCR was performed with the reversed cDNAs as substrates and the MeSWEET10a specific primers (F: 5’-TCCTCACCTTGACTGCGCTG-3’; R: 5’-AGCACCATCTGGACAATCCCA-3’) by using the SYBR Premix Taq Kit (TaKaRa, Dalian, China) in the ABI7500 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Microbiology 2023Quote: ... the two fragments were introduced into a pHSG397 derivative carrying tesB and scdL1 using the In-Fusion HD Cloning Kit (TaKaRa Bio, Japan). This yielded the pHSGScdL2NY-Kmr plasmid carrying tesB ...
-
bioRxiv - Cell Biology 2023Quote: ... Individual master mixes for each gene of interest were prepared using the TB Green® Premix Ex Taq II (TLi RNaseH Plus) reagent kit (RR820A, Takara Bio) and primer sets ordered from Sigma-Aldrich (Supplementary Table 2) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The amplified fragments required to generate the chimeric receptor were combined with a linearized pCS2+ backbone and annealed using an In-Fusion kit (Takara Bio, 638947). The resulting plasmids were transformed into Top10 chemically competent cells ...
-
bioRxiv - Biochemistry 2023Quote: ... 1,5 µg of plasmid DNA and 1,5 µg pOG44 (encoding the Flp recombinase) were mixed and transfected using CalPhos Mammalian Transfection Kit (Clontech®/Takara, #631312). The transfection medium was replaced by complete DMEM after 24 h ...
-
bioRxiv - Immunology 2023Quote: ... Genomic DNA samples from the patients’s paired tumor tissues and WBCs were used to prepare DNA libraries for DNA sequencing with the ThruPLEX Tag-seq Kit (Takara Bio, USA). The libraries were then pooled and hybridized with pre-designed probes for 95 targeted genes (Integrated DNA Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... and subcloned into a modified pCaSpeR4 vector containing the αTub84B promoter (Marois et al., 2006) using In-Fusion cloning kit (Takara Bio, Japan). Forward primer sequence was 5’-CTAGAGGATCCCCGGGTACCATGGTGAGCAAGGGCGAG-3’ and reverse primer sequence was 5’-TCGAGGGGGGGCCCGGTACCTTAATTGTAAGTAATACTAGATCCAGGGTATAAAGTT GTTC-3’ ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 μg of total RNA was used to make cDNA libraries using prime script RT reagent kit gDNA eraser (Takara Bio Inc.) according to the kit’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... The DNA product was purified from the gel slice using the PCR cleanup and gel extraction kits (740609.50, Takara Bio, Kusatsu, Shiga). The purified DNA was cleaned using AMPure XP (A63881 ...
-
Retrovirus-derived RTL9 plays an important role in innate antifungal immunity in the eutherian brainbioRxiv - Evolutionary Biology 2023Quote: ... The C-terminus of Rtl9 was fused to a 4x GGS linker (ggaggatcaggaggatcaggaggatcaggaggatca)-attached mCherry by means of a cloning enzyme (In-Fusion® HD Cloning Kit, Takara Bio). The purified targeting vector was assessed for its quality by Sanger sequencing and injected into mouse pronuclei at the final concentration of 10 ng/μl ...
-
bioRxiv - Evolutionary Biology 2023Quote: The 3’UTR sequence of CcTRPM gene was amplified by the 3’-Full RACE Core Set with PrimeScriptTM RTase kit (Cat# 6106, Takara, Kyoto, Japan). miRNAs for CcTRPM were predicted by a service provider LC science with two software programs of miRanda (http://www.microrna.org ...
-
bioRxiv - Cell Biology 2023Quote: The cDNA of sorted tdTomato positive hair cells was synthesized using PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time, RR047A, Takara Bio). Synthesized cDNA was subsequently mixed with qPCR primers and TB Green Premix Ex Taq (Tli RNase H Plus ...
-
bioRxiv - Molecular Biology 2023Quote: ... Accurate quantification of mRNA levels was meticulously conducted by employing the GAPDH reference gene and utilizing the cutting-edge SYBR Green kit (Takara, Kyoto, Japan) on the state-of-the-art Real-time PCR Detection System manufactured by Bio-Rad ...
-
bioRxiv - Microbiology 2023Quote: ... The cells were cultured again overnight and subjected to the quantification of mRNA by qRT-PCR using the CellAmp Direct RNA Prep Kit for RT-PCR (Real Time) (3732, Takara Bio Inc.), One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time ...
-
bioRxiv - Microbiology 2023Quote: ... The resulting PCR fragment was subcloned into the KpnI-NotI site of the pCAGGS vector20 using In-Fusion HD Cloning Kit (Takara, Cat# Z9650N). Nucleotide sequences were determined by DNA sequencing services (Eurofins) ...
-
bioRxiv - Developmental Biology 2023Quote: ... the PCR products were subcloned into EcoRV site of pBluescript SK- vector using In-Fusion® HD Cloning Kit (TaKaRa Bio, Japan) and sequenced with the M13 forward primer (5’-GTAAAACGACGGCCAG-3’ ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The PCR products were used as templates to synthesize specific dsRNA using the in vitro Transcription T7 Kit (TaKaRa Biotechnology, Dalian, China) (dsRNA-Vitro ...
-
bioRxiv - Cell Biology 2023Quote: ... Isolated DNA was amplified by PCR using Hot Start TaKaRa LA Taq kit to yield a 10-Kb product (Takara Biotechnology, #RR042A). Primers utilized were the following ...
-
bioRxiv - Biophysics 2023Quote: Retroviral constructs encoding HA3-CXCR4 wild-type or designed variants were generated using the In-Fusion HD Cloning Kit (Takara, ref: 638933). Sequences of interest from the expression constructs mentioned above were amplified by high-fidelity PCR (CloneAmp HiFi PCR Premix ...
-
bioRxiv - Plant Biology 2023Quote: ... The expression of marker genes was detected by qRT-PCR using the One-step TB Green PrimeScriptTM RT-PCR kit II (Takara, Osaka, Japan). All genes were normalized against the level of an actin reference gene (Foo et al. ...
-
bioRxiv - Microbiology 2023Quote: ... The resulting PCR fragment was subcloned into the KpnI-NotI site of the pCAGGS vector10 using In-Fusion HD Cloning Kit (Takara, Cat# Z9650N). Nucleotide sequences were determined by DNA sequencing services (Eurofins) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and inputted into cDNA synthesis by incubation with a mixture of random hexamers and reverse transcriptase (TAKARA PrimeScript RT Reagent Kit with gDNA Eraser, Takara Bio #RR047A). The resulting cDNA was diluted 1:10 and 2 μl of each sample was amplified using a QuantStudio 5 (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2022Quote: ... qPCR was performed using a One-Step SYBR Green Prime ScriptTM RT-PCR Kit II (Perfect Real Time, Clontech, Takara, Kyoto, Japan) with a Thermal Cycler Dice™ system (Takara ...
-
bioRxiv - Molecular Biology 2022Quote: ... qPCR was performed using a One-Step SYBR Green Prime ScriptTM RT-PCR Kit II (Perfect Real Time, Clontech, Takara, Kyoto, Japan) with a Thermal Cycler Dice™ system (Takara ...