Labshake search
Citations for Takara Bio :
2251 - 2300 of 2518 citations for PCR Tube since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 0.4 µ mol of each primer and 0.7 U of Terra PCR Direct Polymerase (ClonTech Europe, Saint-Germain-en-Laye, France).
-
bioRxiv - Microbiology 2021Quote: ... First the coding region of Candid #1 RdRp was amplified using RNA extracted from P0 or P11 viruses and the PrimeScript II High Fidelity One Step RT-PCR Kit (Takara Bio). Kozak sequence ...
-
bioRxiv - Immunology 2021Quote: ... An N-terminal-AcGFP-fused CDC42 expression vector was constructed by incorporating PCR-amplified CDC42 cDNA into the pAcGFP1-C1 Vector (Takara Bio). Each CDC42 variant was generated by PCR-based mutagenesis using KOD plus (Toyobo) ...
-
bioRxiv - Immunology 2021Quote: Amplicons comprising the 5’intron of exon 3 of Sp140 and the end of exon 3 were amplified from crude DNA from ear clips of B6 and Sp140-/- 1 mice (sense: TCATATAACCCATAAATCCATCATGACA; antisense: CCATTTAGGAAGAAGTGTTTTAGAGTCT) with PrimeStar PCR components (Takara, R010b) for 18 cycles according to manufacturer specifications ...
-
bioRxiv - Genomics 2021Quote: ... The four PCR assays were run on a thermal cycler using 10 ng DNA from the ε2/ε2 and ε3/ε3 cell lines with PrimeStar GXL PCR mastermix (Takara Bio) according to the manufacturer’s instruction using 58 °C annealing temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... Donor vectors containing the GFP or mKate2 coding sequence flanked by 1kb homology arms adopted from both 3′ and 5′ sides of the insertion site were generated by cloning of PCR-amplified tags and arms into linearized pGEM-3z vector by In-Fusion HD Cloning Kit (Takara Bio). Obtained gRNA expression plasmids and donor plasmids were injected into the y w embryos with a final concentration of 120 ng/ul for each ...
-
bioRxiv - Developmental Biology 2022Quote: ... respectively) of PCR were performed to amplify the embryo cDNA using the TaKaRa ExTaq HS (TAKRR006B, Takara, final concentration : 0.05U/mL) and IS PCR primer (IDT ...
-
bioRxiv - Cell Biology 2022Quote: ... partial Teneurin2 from KAZUSA cDNA (NCBI AB032953) and RIKEN cDNA (NCBI AK031198) were amplified by PCR and inserted into pEGFP-C1 (Takara Bio). The missing part was complemented by a custom gene synthesis (Eurofins Genomics K.K.) ...
-
bioRxiv - Cell Biology 2022Quote: ... NM_001123007) was amplified from 24 hpf embryo RNA using the PrimeScript II High Fidelity One Step RT-PCR kit (Takara, R026A) and the following primers ...
-
bioRxiv - Neuroscience 2022Quote: ... SEP and DOR sequences were amplified by PCR and inserted into PCAGGS-SE using EcoRI and XhoI sites with a two fragments In-Fusion (Takara Bio) strategy ...
-
bioRxiv - Microbiology 2022Quote: Total RNA was extracted from HT-29 cells using the CellAmp Direct RNA Prep Kit for RT-PCR (3732; TaKaRa, Japan) after the introduction of genomic DNA or Poly (I ...
-
bioRxiv - Synthetic Biology 2022Quote: Single point mutations in all mOptoT7 plasmids were based on previously published plasmids (mOptoT7 Version 1, V1)53 and created using CloneAmp HiFi PCR Premix (Takara Bio). All constructs were transformed into Top10 E ...
-
bioRxiv - Plant Biology 2022Quote: ... Each of the up-regulated genes (MpGSTF7, MpGSTF10, MpGSTF15, MpCYP813A5, MpCYP822A1) was PCR amplified from genomic Tak-2 DNA using CloneAmp HiFi Premix (Takara Bio). The primers used to amplify gene sequences are listed below ...
-
bioRxiv - Plant Biology 2022Quote: ... The expression analysis of each target gene was performed quantitatively by real-time RT-PCR method after cDNA synthesis using PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa) and TB Green® Premix Ex Taq™ II (Tli RNaseH Plus ...
-
bioRxiv - Neuroscience 2022Quote: ... The samples were centrifuged at 16,000 RCF for 5 min at 4°C and the supernatant was reserved for DNA clean-up using NucleoSpin® Gel and PCR Clean-Up (740609, Takara) based on manufacture instructions or ethanol precipitation.
-
bioRxiv - Zoology 2023Quote: ... Primers were designed on each contig (Table S3) and RT-PCR was performed using a 3’ RACE CORE Set (Takara Bio).
-
bioRxiv - Neuroscience 2022Quote: ... Pak1 fragment (amino acids 270–521) was PCR-amplified from pCMV6M-Pak1 and subcloned into pCold-Pros2 vector (Takara Bio Inc.) to generate pCold-Pros2-Pak1cat ...
-
bioRxiv - Molecular Biology 2022Quote: ... The cDNAs (1-5 ng RNA equivalents) were used for real-time PCR amplification using SYBR Premix Ex Taq II (Takara/Clontech) on a 7500 Fast Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2022Quote: ... The amplified linear PCR products containing the desired modification were ligated and transformed into Stellar™ Competent Cells (Takara Bio USA). All sequences were confirmed by DNA sequencing (UC Berkeley DNA Sequencing Facility).
-
bioRxiv - Zoology 2024Quote: ... RNA was extracted using Isogen-LS (Nippon Gene) and RT-qPCR was performed using the One-Step PrimeScript RT-PCR Kit (Takara Bio) on a 7500 Real-Time RT-PCR System (Applied Biosystems) ...
-
bioRxiv - Physiology 2024Quote: cDNA synthesis and Real-Time PCR were performed following the manufacture instructions of the PrimeScript RT reagent Kit with gDNA Eraser kit (Takara, #RR047A). For the Real-Time PCR reaction ...
-
bioRxiv - Physiology 2024Quote: ... Synthesized cDNA samples were used as templates for quantitative PCR using THUNDERBIRD SYBR qPCR Mix (TOYOBO) on a Thermal Cycler Dice Real Time System (Takara Bio). The amount of target RNA was normalized to the endogenous control ribosomal protein 49 gene (rp49 ...
-
bioRxiv - Cell Biology 2024Quote: ... the coding sequence of each gene was amplified from whole larva cDNA using PrimeScript RT-PCR Kit (Takara, cat # RR014-A). The amplified sequence was then purified through gel extraction (Magen HiPure Gel Pure DNA Mini kit ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR products were analysed by gel electrophoresis and positive products were purified using the NucleoSpin Gel and PCR clean up kit (Clontech, Takara Bio) before being sent for sequencing by Eurofins Genomics (Germany) ...
-
bioRxiv - Developmental Biology 2024Quote: ... three primer sets were designed with overlapping sections,100ng of Genomic DNA was used per PCR reaction with primeSTAR GXL DNA polymerase (Takara Bio) using a touchdown PCR for the first 10 cycles from 72 to 60 followed by 35-40 cycles at the proper annealing temperature (Tm −2°C ...
-
bioRxiv - Neuroscience 2023Quote: ... expressing UAS-eGFP was subjected to 14 cycles of PCR amplification (SMARTer Seq V4 Ultra Low Input RNA Kit; Takara Bio). 1 ng of amplified RNA was used to prepare cDNA libraries (Nextera XT DNA library preparation kit ...
-
bioRxiv - Biochemistry 2024Quote: ... PCR amplifications for synthetic genes and a linear-pET-22b (+) vector were performed with using PrimeSTAR® Max DNA polymerase (TaKaRa) and the designed primers (Supplementary Table 1 ...
-
bioRxiv - Genetics 2024Quote: ... oligonucleotide primers were designed to introduce the respective mutant sites using the PCR-based In-Fusion cloning technique (Takara Bio, Japan). The transgenes with human reference wildtype COL4A5 and select patient-derived variants were introduced to the 51C attP landing site on the second chromosome by Rainbow Transgenic Flies (CA ...
-
bioRxiv - Biophysics 2024Quote: ... PCR products were overlapped and assembled to create Vpr-StayGold with In-Fusion Snap Assembly cloning kits (Takara Bio, no. 638947); successful insertion was verified by sequencing.
-
bioRxiv - Cell Biology 2024Quote: ... followed by quantitative RT-PCR (qRT–qPCR) using the TB Green® Premix Ex Taq™ (Tli RNaseH Plus) (RR420A, Takara). Data were normalized to GAPDH expression utilizing the 2-ΔΔCT method ...
-
bioRxiv - Plant Biology 2022Quote: ... the full-length coding sequence of PLP with His6 at the N terminus was amplified by PCR and inserted into SalI-digested pBYR2HS vector using the In-Fusion Snap Assembly Master Mix (Takara Bio). The leaves of four-week-old N ...
-
bioRxiv - Biochemistry 2023Quote: ... Total RNA was further purified using mRNA Dynabeads and the purified mRNA was used as template for synthesis of cDNA using SMARTer PCR cDNA kit (Takara-Bio), with 18 cycles of amplification ...
-
bioRxiv - Biochemistry 2022Quote: ... KM881710.2) were PCR amplified from viral cDNA templates (31–33) and cloned into pSUMO expression plasmid by IN-FUSION (Takara Bio). The final constructs were confirmed by sanger sequencing performed by Genewiz.
-
bioRxiv - Molecular Biology 2023Quote: ... and mmpL3 were amplified from Mtb H37Rv genomic DNA by PCR and inserted into pGW1-6C (gift of Tom Alber, University of California, Berkeley) by InFusion (Takara Bio) for wild-type genes or by ligation for recoded gene variants using restriction sites SpeI and NdhI ...
-
bioRxiv - Microbiology 2023Quote: ... These identical sequences were generated via PCR with primers that contain a 5’ end identical to an adjacent segment and a 3’ end that anneals to the gene-of-interest sequence using a 2x hot-start PCR master mix (Takara, #R405A). The primers for PCR reactions were listed in Table 2.
-
bioRxiv - Cell Biology 2023Quote: ... A full-length Sfrp1 cDNA fragment was obtained by PCR amplifying mouse kidney cDNA using PrimeStar HS DNA polymerase (Takara Bio) following manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Bcl-2 and PTEN were detected by RT-PCR with TB Green TM Premix Ex TaqTM II(Tli RNaseH Plus) (RR820A, Takara, Japan). The complete gene sequences showed in Table 2 were searched from the National Center for Biotechnology Information (NCBI ...
-
bioRxiv - Cancer Biology 2023Quote: ... MYCN coding region was PCR amplified from HA-MYCN construct and cloned into the doxycycline inducible pLVX-pTetOne-puro vector (Takara Bio) using In-Fusion HD kit (Takara Bio ...
-
bioRxiv - Cell Biology 2023Quote: RACE-ready (Rapid Amplification of cDNA 5’ Ends) cDNA was generated using SMARTer PCR cDNA Synthesis Kit (#634925, Clontech Laboratories, Inc.) according to the manufacturer’s protocol.
-
bioRxiv - Genetics 2023Quote: ... Molecular cloning was performed using PCR to generate fragments with 15 bp overlapping ends and then assembling the fragments using In-Fusion Enzyme (Takara Bio) prior to transformation into chemically competent E ...
-
bioRxiv - Genomics 2023Quote: ... a vector containing homology arms was generated by PCR-amplification of HAP1 gDNA and cloning of products into a linearized pUC19 backbone (InFusion, Takara Bioscience). Primers for these PCRs were designed such that homology arms would be between 200 bp and 1300 bp ...
-
bioRxiv - Genomics 2023Quote: ... purified via gel extraction from a 1% agarose gel followed by cleanup using the NucleoSpin PCR clean up and gel extraction kit (Takara Bio). Linearized CROP-seq-optiI and amplified oligonucleotides were assembled using the NEBuilder HiFi DNA assembly cloning kit (NEB ...
-
bioRxiv - Biochemistry 2022Quote: ... a DNA fragment encoding residues 1-132 was amplified using the RPA expression plasmid as a template and CloneAmp Hi-Fi PCR master mix (Clontech, Takara) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... A total of 100 ng isolated RNA was used for cDNA synthesis using PrimeScript High Fidelity RT-PCR Kit (Takara, R022B). RT-qPCR was performed using TB Green® Premix Ex Taq™ (Tli RNase H Plus ...
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR was performed in a single-step using the One-Step TB Green PrimeScript RT-PCR Kit II (Takara Bio). The HCoV-OC43 nucleocapsid gene was amplified with the following primers ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was then subjected to the real time PCR for specific gene target by TB Green Premix Ex Taq (TaKaRa, RR420B) according to manufacturer’s instructions using Real Time PCR system (SIS-PCR005 ...
-
bioRxiv - Microbiology 2023Quote: ... Real-time PCR was performed using THUNDERBIRD Next SYRB qPCR Mix (TOYOBO) on a real-time PCR system (Thermal Cycler Dice® Real Time System, Takara).
-
bioRxiv - Cancer Biology 2023Quote: ... A bead ratio of 1x was used (50 µL of AMPure XP beads to 50 µL cDNA PCR product with 1 µL of 10x lysis buffer added, as per Clontech instructions), and purified cDNA was eluted in 17 µL elution buffer provided by Clontech ...
-
bioRxiv - Plant Biology 2023Quote: ... qPCR reactions were implemented in an Applied Biosystems 7500 Real-Time PCR system with the SYBR® Premix Ex TaqTM II (TAKARA). ACTIN was used as the reference gene for qPCR analyses ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting PCR product was cloned between the 3’ and 5’ arms of the Rosa26 targeting vector using In-Fusion cloning (Takara Bio). Plasmid sequence was checked by sequencing ...