Labshake search
Citations for Takara Bio :
1901 - 1950 of 3733 citations for hsa let 7f RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... All the DNA templates were prepared by PCR (Takara) unless otherwise noted ...
-
bioRxiv - Developmental Biology 2023Quote: ... followed by PCR amplification using Ex-Taq polymerase (Takara) and template cDNA ...
-
bioRxiv - Immunology 2024Quote: ... qRT-PCR was conducted using TB Green fluorescence (TaKaRa) on a MasterCycler EP Realplex 4 thermal cycler (Eppendorf ...
-
bioRxiv - Microbiology 2023Quote: ... PCR was performed using KOD DNA polymerase (Takara Bio) with the following settings ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR product was ligated with InFusion ligation enzyme (TaKaRa) on EPB71 backbone (Addgene plasmid #90018 ...
-
bioRxiv - Microbiology 2023Quote: ... Viral cDNA was PCR amplified using CloneAmp HiFi (TaKaRa) in four overlapping amplicons of about 2.2 kb ...
-
bioRxiv - Biochemistry 2024Quote: ... The PCR product was treated with DpnI (TaKaRa Bio) at 37 °C for 1 h and transformed into Escherichia coli JM109 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... using the Advantage® 2 PCR Kit (Takara Bio) in a touchdown cycling program as follows ...
-
bioRxiv - Microbiology 2020Quote: ... HSP70-F2/R2 primers (Table S1) and ligated into pBS-SK+ using the In-fusion HD Cloning kit (Clontech, Beijing, China), respectively ...
-
bioRxiv - Neuroscience 2021Quote: The 5’UTR promoter region of mouse L1Spa belonging to LINE-1 Tf family was amplified with the primers (Fw; AATGGGCAGAGCTCGTTTAG, Rv: CTGGTAATCTCTGGAGTTAG) and Takara LA Taq polymerase with GC buffer (Takara Bio) using pTN201 plasmid (a kind gift from Dr ...
-
bioRxiv - Molecular Biology 2021Quote: ... fluorescence-labeled primers were designed and the DNA fragment amplified from genomic DNA of HEK293T cells using Gflex DNA polymerase (Takara-bio). Amplicons were purified using NucleoSpin Gel and a PCR Clean-up kit (Takara-bio ...
-
bioRxiv - Molecular Biology 2021Quote: ... A pair of gene specific primers TaAFR-F and TaAFR-R (S1 Table) and Tks Gflex™ DNA Polymerase (TaKaRa, Japan) were used to amplify the full-length coding sequences CDS amplified with Tks Gflex™ DNA Polymerase (TaKaRa ...
-
bioRxiv - Cell Biology 2021Quote: ... D4H was generated by site-directed mutagenesis using the primers 5’-TGTTTTAGATTGATAATTTCCATCCCATGTTTT-3’ and 5’-CGGACTCAGATCTCGAAGGGAAAAATAAACTTAGA-3’ and inserted into pEGFP-C2 vector (TaKaRa Bio) by the In-Fusion reaction ...
-
bioRxiv - Microbiology 2020Quote: ... the full-length cDNA of PacC amplified with primers PacC-F and PacC-R was digested with EcoRI and cloned into pGBKT7 (Clontech, USA) as pBD-PacC559 ...
-
bioRxiv - Bioengineering 2020Quote: ... with specific primers (Suppl. Table 1) from pP121K-AcGFP1 [15] and inserted between the SalI and BglII sites of pTRE3G (Takara Bio) using NEBuilder HiFi DNA Assembly Mater Mix (New England BioLabs ...
-
bioRxiv - Immunology 2022Quote: ... for continuous fluorescence detection in a total volume of 10 μL of cDNA/control and gene-specific primers using SYBR Premix Ex Taq (TaKaRa Bio). The mRNA levels of the target genes were normalized relative to those of Gapdh using the following formula ...
-
bioRxiv - Zoology 2020Quote: ... the longer fragment containing the complete coding sequence of MYL2 was amplified from the longissimus dorsi muscle tissue with special paired-primers and Taq enzyme (Takara, Japan), and then the complete coding sequence of the target gene was amplified with special primers with restriction enzyme cutting sites and protecting bases ...
-
bioRxiv - Molecular Biology 2019Quote: ... with a universally tailed poly-dT primer and a template switching oligo followed by amplification for 12 cycles with the Advantage 2 DNA Polymerase (Takara Bio). After ultrasonic shearing (Covaris LE220) ...
-
bioRxiv - Microbiology 2020Quote: ... The 5’ RACE reaction was performed with an ac13-specific primer (ac13-GSP1) using a SMARTer® RACE 5’/3’ Kit (TaKaRa) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... was amplified with primer FvGID1a-P-KpnI-F and FvGID1a-P-SalI-R (TableS2) and ligated into pAbAi vector (Clontech Inc.) at KpnI and SalI sites ...
-
bioRxiv - Immunology 2021Quote: ... First strand cDNA synthesis was performed with 4 μg of total RNA per reaction using PrimeScript™ II 1st Strand cDNA Synthesis Kit and oligo-dT primer (TAKARA) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... The IVT RNA is transferred into cDNA with random primers with SMART MMLV kit by following the manufactory protocol (TaKaRa, 639524). 100ng RNA was used for each library preparation ...
-
bioRxiv - Microbiology 2020Quote: ... was amplified using primers C.9 and C.10 and cloned into pOPINF using the In-Fusion HD EcoDry cloning kit (Takara Bio).
-
bioRxiv - Cell Biology 2022Quote: ... For gene analysis the cDNA was amplified using gene specific primers by qPCR with Takara 2X SYBR Green Mix (Takara RR420A) and analyzed in real time PCR machine (7500 Applied Biosystems) ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR products were amplified with specific primers based on the off-target sites and purified products were cloned into pMD19-T vector (TaKaRa, Japan) for Sanger sequencing ...
-
bioRxiv - Plant Biology 2022Quote: ... The PCR reaction was performed with a Biorad CFX384TM Real Time System PCR machine and forward and reverse gene-specific primers (0.5 μM, Table S2) using the SYBR® Premix Ex Taq™ (Tli RNaseH Plus) from Takara Bio ...
-
bioRxiv - Neuroscience 2022Quote: ... sad-1 was cloned into PCR8 vector using the following primers 5’ TCCGAATTCGCCCTTCGTCAATCGGGCAAAGTC 3’ and 3 ’GTCGAATTCGCCCTTGATGATAGATTAGACTTTATCAGCC 5’ with help of infusion reaction (Takara, 638947). For making Pmec-7::mec-7::gfp (cDNA ...
-
bioRxiv - Microbiology 2023Quote: ... 2 µL of the cDNA was used as DNA template in 15-µL amplification volumes with 400 nM of each primer and 7.5 µL of SYBR green master mix (Takara, Beijing, China) using the following cycling parameters ...
-
bioRxiv - Molecular Biology 2023Quote: ... A total of 1 μg of total RNA was reverse-transcribed with random primers using the PrimeScript™ 1st strand cDNA Synthesis Kit (TaKaRa) according to the manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... Synthesized cDNA was subsequently mixed with qPCR primers and TB Green Premix Ex Taq (Tli RNase H Plus, RR420A, Takara Bio). Real-time PCR quantification was performed using Cobas z 480 analyzer (Roche Diagnostics GmBH) ...
-
bioRxiv - Microbiology 2023Quote: ... The ∼21.3 kb cps operon from galF through gnd was amplified in two pieces of overlapping amplicons with primers that also directed recombination with pMQ300 using PrimeSTAR GXL high fidelity polymerase (Takara Bio). Primers to amplify the DNA were 5470 (5’-ttgtgagcggataacaatttcacacaggaaacagctGTGAAGATGAATATGGCGAATTTG-3’ ...
-
bioRxiv - Plant Biology 2023Quote: ... 5′ Rapid amplification of cDNA ends (RACE) was performed using the primer-R5 (Supplemental Table 5S) with the 5′ Full Race Core kit (TAKARA, Japan). The bioinformatics analysis of CcSHMT1 sequences show in Supplemental marterial ...
-
bioRxiv - Developmental Biology 2023Quote: ... Quantitative RT-PCR for pluripotency and trilineage spontaneous differentiation was performed according to the instruction manual of the human ES cell Primer Array (Takara Clontech).
-
bioRxiv - Evolutionary Biology 2024Quote: ... according to manufacturer’s recommendations and using primers specifically designed for the In-Fusion cloning system (Takara Bio, Mountain View CA, USA). The amplified PCR fragments were recombined into the yeast bait two-hybrid vector pGBKT7 (Takara Bio ...
-
bioRxiv - Immunology 2024Quote: ... Two-step PCR to amplify gag or pol region was performed with eight different primer pairs (Supplemental Table 1) and Ex-Taq (TaKaRa-Bio) as described previously (17) ...
-
bioRxiv - Molecular Biology 2023Quote: Cell-free RNAs were captured using random primers with a unique sample barcode and then reverse transcribed with SMARTScribe reverse transcriptase (Clontech, 639538) and template-switching oligos tagging 8-nt UMI sequences ...
-
bioRxiv - Plant Biology 2023Quote: ... Two PCRs were carried out by using nested primers designed on the adaptator and on the paromomycin resistance gene using the Advantage® GC genomic LA polymerase mix (Clontech). PCR products were subcloned for sequencing and blasted on the C ...
-
bioRxiv - Cancer Biology 2024Quote: ... Amplification of cDNA product was performed using specific primers with the TB Green® Premix Ex Taq™ II (Takara, RR820B) on a Real-Time PCR detection system (BioRad) ...
-
bioRxiv - Immunology 2024Quote: ... A total of 1 μg of total RNA was reverse-transcribed with random primers using the PrimeScript™ 1st strand cDNA Synthesis Kit (TaKaRa) according to the manufacturer’s protocols ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... with the PCR product of the W56-EGFP-Linker-Synapsin1a region from pAAV-hSyn1-W56-EGFP-Linker-Synapsin1a (FWD and REV primers: 5’-GGCGCGCCCTAGAATTTCAGTCGGAGAAGAGGCTGGC-3’ and 5’-ATGCTAGGCCACCATGATGGTGGACGGCAAGCCC-3’, respectively) using In-Fusion cloning (TaKaRa Bio). pAAV-hSyn1-DIO-Scr-EGFP-Linker-Synapsin1a was generated by replacing the TurboID region of pAAV-hSyn1-DIO-TurboID (EcoRI/NcoI sites ...
-
bioRxiv - Molecular Biology 2024Quote: ... fragmented RNA library was mixed with 5 µM of PE2-N6 primer (Supplementary Table S1) and reverse transcribed using PrimeScript RTase (Takara, SD0418) for 60Lmin at 42L°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... The fragments of the mutated DNA library were amplified with primers M13-Plus-FP/M13-Plus-RP and the linearized pUC57-T7Q vector was amplified with primers AS-FP/AS-RP using PrimerSTAR HS DNA polymerase (Takara, R040A) (Supplementary Table S4) ...
-
bioRxiv - Bioengineering 2023Quote: Nanobody sequences were amplified by PCR with the specific primers (NbFt-F: gcaagatctgccaccatggcc CAGGTGCAGCTGCAGGAG; NbFt-R:gcaaagcttggatccAGCGTAATCTGGAACATCGTATGGGTA tgcggccgctgagga) and subcloned into the retroviral vector pMSCV (Clontech, Takara Bio, US). HEK-293T cells were grown in 10cm plates and cotransfected with plasmids expressing GFP-mFerritin and anti-ferritin nanobody clones using PEI (DNA:PEI=1:3) ...
-
bioRxiv - Microbiology 2020Quote: ... The amplification of viral DNA by PCR was carried out base on the manufacturer’s recommendations of the LA PCR Kit (TaKaRa Biomedical Technology Beijing, China). Briefly ...
-
bioRxiv - Pathology 2022Quote: ... PCR was performed using Quick Taq HS DyeMix (Toyobo, Osaka, Japan) and a PCR Thermal Cycler Dice (TP650; Takara Bio Inc., Shiga, Japan), with the following cycling conditions ...
-
bioRxiv - Microbiology 2020Quote: ... and qRT-PCR was performed on StepOne Plus Real-time PCR system (Applied Biosystem) with TB Green Premix Ex Taq II (Takara Cat no. RR820A). Briefly ...
-
bioRxiv - Molecular Biology 2020Quote: ... Reverse transcription of the total RNA to complementary DNA and amplification of cDNA templates by long-distance PCR (LD-PCR) were performed using SMARTer Ultra-low Input RNA for Illumina Sequencing-HV (Clontech Labaratories, CA, USA) kit ...
-
bioRxiv - Plant Biology 2019Quote: High-throughput qRT-PCR reactions were performed using the WaferGen SmartChip Real-time PCR system (5184-nanowells chip, WaferGen Bio-systems and Takara Bio Inc. USA). qRT-PCR reaction volumes of 100 nL consisted of 1 X LightCycler 480 SYBR Green I Master (Roche Diagnostics France) ...
-
bioRxiv - Plant Biology 2020Quote: ... The band intensity of products obtained from semi-Q PCR was observed on the agarose gel and was further characterized with qRT-PCR using SYBR Green ® Premix (Takara Bio, USA). Specific primers were designed for studying expression of stress related genes in Arabidopsis and RP genes in rice using primer3 (v.0.4.0 ...
-
bioRxiv - Molecular Biology 2023Quote: ... was performed by quantitative real-time polymerase chain reaction (PCR) using the AAVpro™ Titration Kit (for Real Time PCR) Ver.2 (Takara Bio Inc), according to the manufacturer’s instructions ...