Labshake search
Citations for Takara Bio :
2001 - 2050 of 3733 citations for hsa let 7f RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Zoology 2023Quote: ... First- strand cDNA was synthesized from total RNA using the PrimeScript RT Reagent Kit with gDNA Eraser (Takara Bio, Shiga, Japan). PCR amplifications were performed using the KOD One PCR Master Mix (TOYOBO ...
-
bioRxiv - Developmental Biology 2023Quote: ... was eliminated by digesting with genomic DNA eraser buffer and cDNA was obtained by reverse transcription of RNA using PrimeScript RT reagent Kit with gDNA Eraser (Takara, RR047A). To measure the values of genes specifc primers ...
-
bioRxiv - Bioengineering 2023Quote: ... Cerulean and Myo7b blots were stained for 1 h at room temperature (RT) or overnight at 4 °C using the mouse anti-GFP (detects cerulean, 1:2000, JL-8, Clontech, Takara) and the mouse anti-β-tubulin antibody (1:500 ...
-
bioRxiv - Plant Biology 2023Quote: First-strand cDNA was synthesized from purified total RNA using PrimeScript RT Master Mix (Perfect Real Time; Takara Bio, Shiga, Japan) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... Each sample (2 μg) of total RNA was used to synthesize first-strand cDNA with a PrimeScript RT Kit with gDNA eraser (Takara, RR0447A). RT-qPCR was performed using a Roche LightCycler 480 system with a SYBR Fast qPCR Kit (KAPA Biosystems ...
-
bioRxiv - Plant Biology 2023Quote: ... which was then reverse-transcribed into first-strand cDNA using the Prime-Script-TM RT Reagent Kit (RR036, Takara, Kyoto, Japan). The quantitative real-time polymerase chain reaction was performed using the ABI 7300 sequencer and SYBR Premix Ex Taq-TM (RR420 ...
-
bioRxiv - Cell Biology 2024Quote: ... rat cerebral cortexes or fly brains using TRIzol and the reverse transcription was performed with PrimeScript™ RT Master Mix (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... The RNA was then reverse-transcribed into complementary DNA (cDNA) using the RR036A PrimeScript™ RT Reagent Kit (Perfect Real Time) supplied by TaKaRa. The amplification products were quantified using SYBR Green (Vazyme) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... cDNA was synthesized from 100 µg of total RNA by Prime ScriptTM RT reagent kit with gDNA Eraser (Takara, Tokyo, Japan). Each cDNA sample was amplified for the gene of interest and β-actin in a 15 µL reaction volume TB GreenTM Premix Ex Taq™ II (Takara ...
-
bioRxiv - Genomics 2023Quote: ... The same amount of input RNA for each batch was used for reverse transcription (RT) reactions with SMARTScribe™ Reverse Transcriptase (Takara) and oligo dT following the manufacturer’s manual ...
-
bioRxiv - Developmental Biology 2023Quote: ... Reverse transcription of 500 ng purified total RNA was performed by PrimeScript RT reagent kit with gDNA Eraser (Takara, Dalian, China). RT-qPCR was performed with SYBR green master mix (Takara ...
-
bioRxiv - Neuroscience 2024Quote: Total RNA (500 ng) was reverse transcribed to cDNA using the PrimeScript™ RT Reagent Kit with gDNA Eraser (Takara, RR047A). qPCR was carried out using PowerUp™ SYBR™ Green Master Mix kit and detected by QuantStudio3 system (Thermo Fisher) ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA was extracted as described for RNA sequencing and cDNA was generated using the PrimeScript RT reagent kit (Takara, cat. #RR037A) using a mix of oligo dT and random hexamer primers ...
-
bioRxiv - Molecular Biology 2024Quote: ... 500 ng of total RNA underwent reverse transcription to generate cDNA using the primeScriptTM RT Master Mix reagent kit (TaKaRa, Japan). Quantitative assessment of relative RNA expression was performed via RT-qPCR using SYBR Premix Ex TaqTM (TaKaRa ...
-
bioRxiv - Immunology 2023Quote: ... Reverse transcription was performed on 1 µg total mRNA per sample using PrimeScript™ RT Reagent Kit with gDNA Eraser (Takara) according to the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2024Quote: ... genomic DNA removal and reverse transcription were carried out using the PrimeScript™ RT reagent kit with gDNA Eraser (Takara Bio).
-
bioRxiv - Cell Biology 2024Quote: ... Complementary DNA (cDNA) synthesis was carried out with 1 μg of RNA using the PrimeScript RT reagent kit (Takara-#RR037A-4). The cDNA was diluted and semiquantitative and Real-time PCR techniques were performed ...
-
bioRxiv - Plant Biology 2020Quote: ... was then used for RT-qPCR with the primers shown below with THUNDERBIRD® qPCR Mix (TOYOBO) on a Thermal Cycler Dice Real Time System (Takara Bio). Radish Glyceraldehyde 3-phosphate dehydrogenase (GAPDH ...
-
bioRxiv - Cell Biology 2021Quote: Both mAlkbh5 and mAlkbh5-HAtag were amplified from the cDNA using gateway forward and reverse primer using PrimeSTAR GXL DNA Polymerase (Takahara Clontech # R050A-TAK), and the PCR product was purified using QIAquick PCR Purification Kit (Qiagen #28106) ...
-
bioRxiv - Molecular Biology 2020Quote: ... was amplified using specific primers (forward: 5’-AAGGAGATATACATATGCTCTCCGAAATGGTGGAAGAAG-3’; reverse:5’-GTGCGGCCGCAAGCTTTTATTTCTTTTTGTTGGTGGTCTG-3’) and cloned into pET28a using an InFusion HD Cloning Kit (Takara Bio USA) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The forward primer contained a Kozak sequence and both primers contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). To make pmCherry-N1-Gal3 ...
-
bioRxiv - Cell Biology 2021Quote: The SYP121 DNA (obtained from Riken) was amplified from cDNA with primers excluding the transmembrane domain and cloned into the pGADT7 vector (Clontech Laboratories, Inc.). All other exocyst constructs used in the study have been previously described [38,48,73](Hála et al. ...
-
bioRxiv - Microbiology 2021Quote: ... plantarum 16S rRNA genes were amplified from individual colonies using the 27F and 1492R primers (Lane et al. 1991) (Table S8) with ExTaq DNA polymerase (TaKaRa, Shiga, Japan). Thermal cycling conditions were as follows ...
-
bioRxiv - Microbiology 2020Quote: ... The erythromycin resistance gene was amplified from plasmid pMG36e using primer pair EmrF/EmrR and then connected with linearized pMD19-GmloxP using In-Fusion HD Enzyme (Takara, Daliang, China), generating the plasmid pMD19-EmrloxP ...
-
bioRxiv - Bioengineering 2020Quote: ... cDNA was synthesized using a mix of random hexamers – oligo d(T) primers and PrimerScript reverse transcriptase enzyme (Takara bio inc. Kit), again following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... 2006) using primers pDAN0869 and pDAN0870 and recombined with pK7SHHc digested with AvrII using In-Fusion HD cloning (Clontech, Mountain View, California) to generate pK7-VEN-SHHc.
-
bioRxiv - Plant Biology 2022Quote: ... The qRT-PCR was performed with the reversed cDNAs as substrates and the MeSWEET10a specific primers (F: 5’-TCCTCACCTTGACTGCGCTG-3’; R: 5’-AGCACCATCTGGACAATCCCA-3’) by using the SYBR Premix Taq Kit (TaKaRa, Dalian, China) in the ABI7500 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... KOD FX DNA polymerase (TOYOBO) and primers (supplementary table 1) and then cloned into the BamHI site of pLVSIN-EF1 α Hyg vector (Takara Bio) using an In-Fusion HD Cloning Kit (Takara Bio) ...
-
bioRxiv - Molecular Biology 2024Quote: ... forward = TTTCTAAGACTCTCTCCCGTA and reverse = GATTAGAAGTAGCCGACCAA) was labeled with dCTP [α-32P] using Random Primer DNA Labeling Kit Ver.2.0 (Takara, catalog #6045). The hybridization was done at 65°C overnight in Church and Gilbert Moderate Hybridization Buffer (1% BSA ...
-
bioRxiv - Plant Biology 2024Quote: ... 1000 ng of DNase-treated RNA was used in a 20 µL reaction employing oligo-dT primers and random hexamers according to the protocol provided by Takara (Cat# RR014B). The relative expression levels of the target genes were assessed via qPCR ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µg RNA was subsequently converted to cDNA using random hexamer primer using PrimeScript™ 1st strand cDNA Synthesis Kit (Takara Bio) in accordance with manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2023Quote: Nanobody sequences were amplified by PCR with the specific primers (NbFt-F: gcaagatctgccaccatggcc CAGGTGCAGCTGCAGGAG; NbFt-R:gcaaagcttggatccAGCGTAATCTGGAACATCGTATGGGTA tgcggccgctgagga) and subcloned into the retroviral vector pMSCV (Clontech, Takara Bio, US). HEK-293T cells were grown in 10cm plates and cotransfected with plasmids expressing GFP-mFerritin and anti-ferritin nanobody clones using PEI (DNA:PEI=1:3) ...
-
bioRxiv - Plant Biology 2020Quote: ... were amplified by PCR using PrimeSTAR GXL DNA polymerase (Takara) and gene-specific primer sets ...
-
bioRxiv - Cell Biology 2020Quote: ... sgRNA inserts were PCR amplified using ExTaq DNA Polymerase (Takara). The resultant PCR products were purified and sequenced on a HiSeq 2500 (Illumina ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR was performed using SYBR Green Mix (Takara Bio, Japan). The primer sequences were shown in Table 1.
-
bioRxiv - Genetics 2021Quote: ... Colony PCR was performed using Takara Taq polymerase (Clontech, TAKR001C). Plasmid DNA was isolated from cultured bacteria using QIAprep Spin Miniprep Kit (Qiagen ...
-
bioRxiv - Developmental Biology 2020Quote: ... qRT-PCR was performed via SYBR Premix Ex Taq (Takara) and Rotor-Gene 3000 system (Corbett Research) ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR reaction consisted of PrimeSTAR Max Premix 1x (Takara Bio), 0.4 μM of each primer and 30-100 ng DNA template ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR was conducted using PrimeSTAR Max DNA Polymerase from TaKaRa. The PCR products were checked by agarose gel electrophoresis and inserted into pET28a plasmid between the BamHI and EcoRI sites with Gibson Assembly method ...
-
bioRxiv - Immunology 2019Quote: ... The RACE PCR products were cloned into pMD-19Tvector (Takara) and sequenced.
-
bioRxiv - Neuroscience 2019Quote: ... The PCR product was InFusion-cloned (Clontech, catalogue number 639645) into the pBAC-ECFP-15xQUAS-TATA-SV40 plasmid7 (Addgene #104875) ...
-
bioRxiv - Neuroscience 2020Quote: ... and then amplified by PCR using PrimeStar HS polymerase (Takara). Primers for amplifying the prenyl-Cdc42 coding sequence and 3’UTR were engineered to contain terminal Not I and Sal I restriction sites ...
-
bioRxiv - Immunology 2021Quote: ... a semi-nested PCR was performed using PrimeStar MAX (Takara) for 35 cycles ...
-
bioRxiv - Immunology 2021Quote: ... PCR was performed for 35 cycles using PrimeStar MAX (Takara). Primers used for these reactions can be found in Supplementary Table 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR products were sub-cloned in pEGFP expression vectors (Clontech). KIF13B was amplified by PCR from GFP-KIF13B and inserted into a Bio-mCherry-C1 vector to make mCherry-KIF13B ...
-
bioRxiv - Neuroscience 2021Quote: ... Viral titers were assayed by Lenti-X qRT-PCR (Clontech) and titers were adjusted to 1×108 copies/ml before injection.
-
bioRxiv - Plant Biology 2021Quote: ... PCR amplified products (PrimeSTAR GXL DNA Polymerase, TaKaRa Bio Inc.) using primers and DNA templates listed in Table S4 were cloned into pLRE::LRE-cYFP plasmid linearized with SpeI-HF and AscI by using the In-Fusion HD Cloning Plus system (Clontech) ...
-
bioRxiv - Microbiology 2020Quote: ... Real-time PCR was performed with 2x SYBR mix (Takara) in a QuantStudio-6 Flex Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2020Quote: ... then amplified by PCR with PrimeSTAR pre-mix HS (Takara), and cloned into pCR4Blunt-TOPO (ThermoFisher) ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR fragments were annealing in 1X prime star buffer (Takara) and Surveyor enzyme was added to digest the annealed DNA fragments at 42 °C for 1h ...