Labshake search
Citations for Takara Bio :
1801 - 1850 of 6767 citations for ssc mir 299 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... PCR templates were generated by PCR reaction with biotinylated primers using high fidelity ClonAmp HiFi PCR mix (Takara Inc.). A mixture of Cas9-mSA mRNA (75ng/μl) ...
-
bioRxiv - Developmental Biology 2022Quote: ... PCR templates were generated by PCR reaction with biotinylated primers using high fidelity ClonAmp HiFi PCR mix (Takara Inc.). A mixture of Cas9-mSA mRNA (75ng/ml) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1D libraries were prepared according to ONT protocol with 1D PCR Barcoding kit and full length non-directional sequencing was performed on PromethION instrument (using Clontech-SMART-Seq v4 Ultra Low Input kit). Basecalling was conducted using guppy version (v6.4.2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... ssDNA was purified using the Nucleospin Gel and PCR Clean-up kit (Machery-Nagel, distributed by Takara Bio USA) with buffer NTC used as recommended by the manufacturer ...
-
bioRxiv - Plant Biology 2020Quote: ... This was followed by a nested PCR and cloning of the products using the Mighty TA-cloning kit (TaKaRa). Twenty independent clones were randomly picked and sequenced.
-
bioRxiv - Microbiology 2021Quote: ... The PCR product of the assembled sequence was purified with a DNA Fragment Purification Kit (Takara, Dalian of China) and eluted with ddH2O ...
-
bioRxiv - Molecular Biology 2022Quote: ... qRT-PCR was carried out by using TB Green Premix Ex Taq II (Tli RNaseH Plus) kit (Takara, China) on ABI7500 Real-time system (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products of EgGLUT1-ss gene were recovered from Agarose Gel with Agarose Gel DNA Extraction Kit (Takara, Japan), and the amplified fragments were cloned into pMD19-T vector with Mighty ta-cloning Reagent Set for Prime STAR (Takara ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and then was transcribed to cDNA using the Clontech SMARTer PCR cDNA Synthesis Kit (Clontech, Mountain View, CA, USA) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... Each sub-cloning was done by using the In-Fusion PCR cloning kit (Clontech Laboratories, Mountain View, CA, USA). Plasmids were integrated at the lys1 gene locus ...
-
bioRxiv - Molecular Biology 2019Quote: ... Full length cDNA synthesis was done from polyA RNA using Clontech SMARTer PCR cDNA synthesis kit (Clontech Laboratories; (23)) ...
-
bioRxiv - Neuroscience 2020Quote: ... The mRNA expression was quantified using the SYBR green PCR kit (TaKaRa SYBRR Premix Ex Taq. II, Dalian, China) in a CFX96 Touch apparatus (Bio-Rad ...
-
bioRxiv - Genomics 2021Quote: ... The molar concentration of the library was determined by quantitative PCR (qPCR) using Library Quantification kit (Takara Bio Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... PCR products were cloned into the transcription vector pTB-207 [88] using the In-Fusion HD Cloning kit (Clontech) as described previously [89] ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... PCR products were cloned into the transcription vector pTB-207 (69) using the In-Fusion HD Cloning kit (Clontech) as described previously (70) ...
-
bioRxiv - Microbiology 2019Quote: ... Purified PCR fragments were inserted into the pHEX2 plasmid (53) using the In-Fusion HD Cloning Plus kit (Clontech). Expression of the transgenes was controlled by the SAG1 promoter and selection was provided by the presence of the HPT selectable marker (50) ...
-
bioRxiv - Immunology 2020Quote: ... 1 μg of RNA per sample was used for first-strand synthesis by SMARTer PCR cDNA Synthesis Kit (Clontech). For quantitative RT-PCR (qPCR) ...
-
bioRxiv - Immunology 2020Quote: ... and a primer (1μM final concentration) binding to the introduced SMARTER oligonucleotide (CTAATACGACTCACTATAGGGC) using the Advantage 2 PCR kit (Clontech) in a 50μl reaction ...
-
bioRxiv - Cancer Biology 2020Quote: ... They are routinely tested for contamination of mycoplasma by using PCR Micoplasma Test Kit (Takara Bio Inc., Shiga, Japan) and confirmed to be negative before performing experiments.
-
bioRxiv - Microbiology 2022Quote: Amplified spike sequence was first gel-purified using NucleoSpin Gel and PCR Clean-up kit (Takara, Cat. No. 740609.5) and then further purified using Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Plant Biology 2022Quote: ... aril and kernel tissues were pooled equally and cDNA was synthesized using the SMARTer PCR cDNA Synthesis Kit (Clontech). Size fractionation and selection (1-2 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Start codon mutant constructs were generated by mutation PCR using the PrimeSTAR Mutagenesis Basal Kit (Takara Bio, Kusatsu, Japan) by replacing AUG with AAG at Met1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR amplified and subcloned into a pCG-strep expression construct using the In-Fusion® HD Cloning Kit (Takara) according to the manufacture’s instructions ...
-
bioRxiv - Genomics 2023Quote: Full-length cDNA was synthesized with 1.0 μg RNA from Diphasiastrum complanatum using the SMARTer PCR cDNA Synthesis kit (Clontech). The first-strand cDNA was amplified with PrimeSTAR GL DNA polymerase (Clontech ...
-
bioRxiv - Neuroscience 2023Quote: ... and the target bands at 14,438 bp were cut and purified with NucleoSpin® Gel and PCR Clean-Up kit (740609.250, Takara). The target amplicons were re-concentrated to > 300 ng/ µL with GlycoBlue™ Coprecipitant (AM9515 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The 13 kb band was purified with gel purification kit (Takara Nucleospin® Gel and PCR Clean-up Midi). Eighty-two base pair single stranded oligos were designed according to the following structure:
-
bioRxiv - Immunology 2023Quote: ... The components of the master mix for the PCR and the PCR programs were set up according to the CloneAmp HIFI PCR protocol (Takara). All generated plasmids were sequenced before use (Eurofins Genomics).
-
bioRxiv - Plant Biology 2024Quote: ... The qRT-PCR analysis was performed using the ABI StepOne Plus PCR system and the SYBR Green Realtime PCR mix (Takara). The ubiquitin gene (Lj5g3v2060710 ...
-
bioRxiv - Cell Biology 2021Quote: ... open reading frames were PCR-amplified using CloneAmp HiFi PCR Premix (Clontech), gel-purified using the Nucleospin® Gel and PCR Clean-Up kit (Macherey-Nagel) ...
-
bioRxiv - Cell Biology 2021Quote: ... Semi-quantitative PCR was performed with EmeraldAmp MAX PCR Master Mix (Takara). Primers for amlplication of Piezo1 and Gapdh genes were listed in our previous study [26].
-
bioRxiv - Developmental Biology 2019Quote: ... PCR for Gibson assembly was performed using CloneAmp HiFi PCR Premix (Clontech) and Q5 high-fidelity DNA polymerase (NEB) ...
-
bioRxiv - Immunology 2020Quote: ... Quantitative PCR amplification was performed using SYBR Green PCR master mix (Takara) using 10ng of cDNA and 200nM of each specific primer on a 7500 Fast Real-PCR system (Applied Biosystems) ...
-
bioRxiv - Immunology 2023Quote: ... The PCR protocol was executed using the Sapphire PCR master mix (TAKARA) following manufacturer protocol ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was reverse-transcribed using PrimeScript™ RT Master Mix (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... cDNA was generated by reverse transcription with commercial PrimeScript RT Master Mix (Takara). Primer pairs (Table S12 ...
-
bioRxiv - Cell Biology 2019Quote: ... One µg of total RNA was reverse-transcribed using PrimeScript RT reagent (TaKaRa) with oligo dT primers ...
-
bioRxiv - Biophysics 2021Quote: ... The cDNA was prepared by PrimeScript™ RT Master Mix (TaKaRa, Dalian, China). The level of virus mRNA was quantified using SYBR Premix Ex Tag II (Tli RnaseH Plus ...
-
bioRxiv - Microbiology 2022Quote: ... was performed with one-step Prime script III RT-qPCR mix (Takara, Japan). The viral RNA of NP was detected by 2019-nCoV-N1 probe (Cat#10006770 ...
-
bioRxiv - Microbiology 2021Quote: ... and reverse transcription was conducted employing the PrimeScript RT Master Mix (Takara, Japan) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... The remaining RT primers were digested on the beads with Exonuclease I (TAKARA) (37°C for 30 min ...
-
bioRxiv - Immunology 2020Quote: ... Purified RNA was reverse transcribed using PrimeScript™ RT Master Mix (RR037A; Takara) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA was synthesized using the PrimeScript RT Master Mix (Takara Bio, Shiga, Japan), and real-time PCR was performed using the Luna Universal qPCR Master Mix (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... the total RNA was converted into cDNA using Prime Script RT Reagents (Takara). In brief ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA was reverse transcribed using anchored oligo-dT and SMARTScribe RT enzyme (Clontech) allowing to add adapter sequences to the 5’ and 3’ ends of RNA fragments ...
-
bioRxiv - Immunology 2023Quote: ... reverse transcribed using the PrimeScript RT Master Mix (TaKaRa Biomedical Technology Co., Ltd.), and quantified by real-time PCR with TB Green Premix Ex Taq (TaKaRa Biomedical Technology Co. ...
-
bioRxiv - Neuroscience 2024Quote: ... RT-qPCR was performed using TB Green Premix Ex Taq II (Takara Bio) and analysed in a Thermal Cycler Dice Real Time System Lite (Takara Bio) ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA was synthesized using PrimeScript™ RT Master Mix (Takara Biotechnology, Japan; RR036A),and a reaction mix was prepared using SYBR green master mix (Yeasen ...
-
bioRxiv - Genetics 2021Quote: ... using InFusion PCR (Takara) as previously described (76) ...
-
bioRxiv - Bioengineering 2022Quote: ... PCR Master Mix (TaKaRa), and 5 µL of template DNA (plasmid standard or sample DNA) ...
-
bioRxiv - Cell Biology 2020Quote: ... to a final concentration of 108-109 IFU/ml using the Lenti-x qRT-PCR Titration Kit (Takara, cat.631235). Lentivirus with MOI of 10 was used for transduction of MOVAS cells ...