Labshake search
Citations for Takara Bio :
1751 - 1800 of 6767 citations for ssc mir 299 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... and in-chip reverse transcription PCR were performed using a 3’ DE Chip and Reagent kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Specific primers were designed for this purpose and PCR was done using the Advantage 2 Polymerase kit (Clontech). Complementary 60 bp-ends to each target sequence on all Mycoplasmas species genome used in this study ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Complete mtDNA was amplified in several overlapping fragments using the Long and Accurate (LA) PCR kit from TAKARA.
-
bioRxiv - Developmental Biology 2023Quote: ... PCR products were cut from agarose gels and purified using the Nucleospin gel purification kit (Takara Bio, 240609). Plasmids were assembled from linear fragments using In-Fusion HD (Takara Bio ...
-
bioRxiv - Developmental Biology 2023Quote: ... PCR products were cut from agarose gels and purified using the Nucleospin gel purification kit (Takara Bio, 240609). Final plasmids were constructed using In-Fusion HD (Takara Bio ...
-
bioRxiv - Immunology 2023Quote: ... linearized BF520 sequence was gel purified using NucleoSpin Gel and PCR Clean-up kit (Takara, Cat. No. 740609.5) and then purified using Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR product was cloned into SalI-PstI-digested pKG120 by In-Fusion HD Cloning Kit (Takara bio). The resulting plasmid ...
-
bioRxiv - Neuroscience 2023Quote: ... First strand cDNA synthesis was performed on 200ng RNA using the SMARTer PCR cDNA Synthesis Kit (Clontech, UK) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... was performed to determine the expression level of transcripts utilizing the SYBR Green PCR master mix kit (Takara). The unique region of transcripts was selected for designing qRT-PCR primers and mentioned in Table S3 ...
-
bioRxiv - Microbiology 2024Quote: ... linearized GPC sequence was gel purified using NucleoSpin Gel and PCR Clean-up kit (Takara, Cat. No. 740609.5) and then purified using Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Genetics 2023Quote: ... The purifications for PALS-C steps were done with NucleoSpin Gel and PCR Clean-Up kit (Takara, 740609). Final assembled products were delivered to Endura Electrocompetent Cells (Lucigen ...
-
bioRxiv - Microbiology 2022Quote: All plasmid inserts were amplified by PCR using standard PCR conditions and the CloneAmp HiFi PCR premix (Takara). Following a PCR purification step (QIAquick PCR purification kit) ...
-
bioRxiv - Immunology 2020Quote: ... qPCR was then carried out using SyberGreen based detection methods (Takara Biosciences). Fold induction relative to the wild type unstimulated sample was calculated as described using 18s and/or GAPDH as reference gene [36] ...
-
bioRxiv - Developmental Biology 2020Quote: ... cDNA was synthesized with PrimeScript RT Master Mix (Takara Bio, Kusatsu, Japan) and full-length cording sequences (CDS ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was synthesized using the 5X PrimeScript RT Master Mix (Clontech/Takara), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was synthesized using the 5X PrimeScript RT Master Mix (Clontech/Takara), following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... and then used for cDNA synthesis with PrimeScript RT Master Mix (Takara). Quantitative PCR analyses were performed using the LightCycler 96 System (Roche Applied Science ...
-
bioRxiv - Cancer Biology 2019Quote: ... cDNA was synthesized using PrimeScript RT Master Mix (Takara Bio, Cat. # RR036A) per the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... then reverse transcribed to cDNA using PrimeScript RT polymerase (Takara, Dalian, China). SYBR Green Master Mix (Tiangen Biotech ...
-
bioRxiv - Biochemistry 2020Quote: ... RNA reverse transcription was performed with 5 × PrimerScript RT Master Mix (Takara). qPCR was performed using a CFX Connect™ Real-Time System (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... Complementary DNA (cDNA) was synthesised using PrimeScript RT Master Mix (Takara Bio). Quantitative reverse transcription-polymerase chain reaction (qRT-PCR ...
-
bioRxiv - Microbiology 2021Quote: ... complementary DNA was synthesized using a Takara RT Master Mix (Takara, Japan), following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... and cDNA was reversely transcribed using PrimeScript™ RT Master Mix (Takara). For quantitative RT-PCR ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was synthesized using a PrimeScript RT Master Mix (Takara, Tokyo, Japan), and quantitative real-time polymerase chain reactions (qRT-PCR ...
-
bioRxiv - Developmental Biology 2019Quote: ... and RT-qPCR was performed with SYBR Premix Ex Taq II (Clontech) on an Applied Biosystems Step One Plus system ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA was synthesized using ReverTra Ace qPCR RT Master Mix (Takara Bio) followed by quantification using the THUNDERBIRD SYBR qPCR Mix (TOYOBO ...
-
bioRxiv - Molecular Biology 2020Quote: ... RT-qPCR was performed with SYBR Premix Ex Taq II (Takara Bio) and primers for genes using a Thermal Cycler Dice Real Time System (Takara Bio) ...
-
bioRxiv - Genetics 2020Quote: ... Total RNA was reverse-transcribed using the PrimeScript RT Master Mix (Takara). RNA from 3-5 adult female whole flies was isolated using TRIzol reagent combined with Chloroform/Ethanol extraction ...
-
Pleiotropy in FOXC1-attributable phenotypes involves altered ciliation and cilia-dependent signalingbioRxiv - Genetics 2020Quote: ... quantified and used for cDNA synthesis with Primescript RT Master Mix (Clontech). qPCR reactions were run with SYBR® Premix Ex Taq (Tli RNAse H Plus ...
-
bioRxiv - Microbiology 2020Quote: ... Reverse transcription was further performed with PrimeScriptTM RT Master Mix (TaKaRa, RR036A) with 400 ng of total RNA as input ...
-
bioRxiv - Cell Biology 2021Quote: ... Reverse transcription was performed using PrimeScript™ RT Master Mix (TaKaRa, RR036A) for novel miRNA and TaqMan™ MicroRNA Reverse Transcription Kit (Applied Biosystems ...
-
bioRxiv - Immunology 2022Quote: ... followed by PrimeScript™ RT Master Mix (Takara Bio, Otsu, Shiga, Japan) for cDNA synthesis in accordance with the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... The extracted RNA was reverse transcribed using PrimeScript RT Master Mix (Takara) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR analysis was performed using TB Green Fast qPCR Mix (Takara) and Thermal Cycler Dice Real Time System II (Takara) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and cDNA was synthesized using Primescript™ RT Master Mix (Takara, RR036B). The cDNAs were then used as templates for qRT-PCR analysis with gene-specific primers ...
-
bioRxiv - Bioengineering 2023Quote: ... and cDNA was synthesized using a PrimeScript RT Master Mix (Takara, Japan). Real-time qRT-PCR was performed on an Applied Biosystems 7500 Fast Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2023Quote: ... Complementary DNA (cDNA) was synthesized using PrimeScript RT Master Mix (Takara Bio). RT-qPCR using GoTaq qPCR Master Mix (Promega ...
-
bioRxiv - Developmental Biology 2023Quote: ... and reverse-transcribed into cDNA using Superscript RT Master Mix (Takara, Japan) as recommended by the manufacturer ...
-
bioRxiv - Developmental Biology 2023Quote: ... RT-qPCR was performed with SYBR green master mix (Takara, Dalian, China) on the ABI Step One System (Applied Biosystems ...
-
bioRxiv - Immunology 2023Quote: ... and reverse transcribed into cDNA with PrimeScript RT Master Mix (Takara, RR036A). The real-time polymerase chain reaction was performed using iQ SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR reactions were performed using CloneAmp™ HiFi PCR Premix (Takara) for 35 cycles with an annealing temperature of 52 °C according to the manufacturer’s suggestions ...
-
bioRxiv - Immunology 2021Quote: ... with the Power PCR TB green PCR master mix (Takara, Japan). 2µl of sample cDNA was used in a total volume of 10µl (3µl primer mix and 5µl of TB green ...
-
bioRxiv - Microbiology 2019Quote: PCR were performed using the Terra PCR Direct Polymerase Mix (Clontech) directly on the cell lysates using the following primers:
-
bioRxiv - Microbiology 2019Quote: PCR were performed using the Terra PCR Direct Polymerase Mix (Clontech) directly on the cell lysates after each round of co-infection ...
-
bioRxiv - Genomics 2020Quote: ... cDNA was PCR-amplified using Terra PCR Direct Polymerase (Takara Bio). Final libraries were prepared using 1ng of cDNA per library with the Nextera XT kit (Illumina ...
-
bioRxiv - Genetics 2020Quote: ... The PCR was done in PrimeStar GXL PCR reaction (TaKaRa, R050A). The primer sequences are:
-
bioRxiv - Immunology 2023Quote: ... PCR was performed on a PCR thermal cycler (Takara, Tokyo, Japan) and real-time PCR was performed using QuantStudio 3 (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... Each PCR reaction was composed of CloneAmp HiFi PCR premix (Takara), 4ng of the plasmid template and 10-20ng of the primer pair mix ...
-
bioRxiv - Microbiology 2024Quote: ... PCR DNA amplifications were performed with CloneAmp HiFi PCR premix (Takara) using Primer-AP (5’ GACCACGCGTATCGATGTCGAC 3’ ...
-
bioRxiv - Plant Biology 2024Quote: ... All PCR reactions were performed using the PCR components from Takara bio Inc ...