Labshake search
Citations for Takara Bio :
901 - 950 of 6736 citations for Onion Yellow Dwarf Virus OYDV PCR Kits since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... mRNA 500 ng was used for cDNA synthesis in 10 μl volume according to the manufacturer’s instructions of PrimeScriptTM RT-PCR kit (Takara Bio Inc., Shiga, Japan). Real-time RT-PCR was then performed using the KAPA SYBR FAST qPCR Master Mix (2x ...
-
bioRxiv - Plant Biology 2020Quote: ... four sequencing libraries (one for each tissue type) were constructed using the SMARTer PCR cDNA Synthesis Kit (ClonTech, Takara Bio Inc., Shiga, Japan) by tissue type with no size selection by NovoGene ...
-
bioRxiv - Plant Biology 2020Quote: ... four sequencing libraries (one for each tissue type) were constructed using the SMARTer PCR cDNA Synthesis Kit (ClonTech, Takara Bio Inc., Shiga, Japan) by tissue type with no size selection by NovoGene ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR amplification using proofreading DNA polymerases (Phusion HF, New England Biolab, Ipswich, MA) and In-Fusion HD Cloning Kit (Clontech, Mountain View, CA) or NEBuilder HiFi DNA Assembly Cloning Kits (New England Biolab) ...
-
bioRxiv - Plant Biology 2021Quote: ... Reverse transcription was then carried out using total RNA and oligo-dT primers to synthesize the first strand cDNA using the PrimeScript One-Step RT-PCR Kit (Ver.2, Takara Biotechnology, Dalian, China) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... for 15 min and then harvested for quantification of INF α mRNA using the One-step SYBR Prime script RT-PCR kit (TaKaRa, Dalian, China) according to the manufacturer’s protocol.Briefly the total RNA was isolated from TNF-α-treated with Trizol reagent (Takara Bio ...
-
bioRxiv - Microbiology 2023Quote: ... and real-time RT-PCR was performed by targeting the SARS-CoV-2 RdRp gene as follows: each 20 µl sample consisted of 12.5 µl One Step PrimeScript™ III RT-PCR Kit (Takara Bio, Shiga, Japan), 0.5 µM Sars-CoV-2 CRV forward primer (5’-TCACCTAATTTAGCATGGCCTCT-3’) ...
-
bioRxiv - Immunology 2023Quote: ... which was measured using a real-time PCR assay with a SARS-CoV-2 direct detection RT‒qPCR kit (Takara Bio, Siga, Japan). The IC50 was calculated by IC50 Calculator (https://www.aatbio.com/tools/ic50-calculator ...
-
bioRxiv - Genomics 2022Quote: ... Extracted RNA from each juvenile (as described in Methods S1) was converted to cDNA using PrimeScript RT-PCR Kit (Takara Bio, Shiga, Japan). The efficiency and specificity of the designed primers was tested through PCR using the GoTaq Green Master kit (Promega ...
-
bioRxiv - Microbiology 2024Quote: ... Extracted RNA samples and DNA standards were then amplified using One Step PrimeScript™ RT-PCR Kit (TAKARA BIO INC, Kusatsu, Shiga, Japan) and the following primer set ((Forward ...
-
bioRxiv - Microbiology 2024Quote: ... Reverse-transcription and amplification were performed using the One Step PrimeScript™ RT-PCR Kit (RR064A, Takara Bio Inc., Kusatsu, JP-25, Japan) with the following forward primer (5’-ATGAGYCTTYTAACCGAGGTCGAAACG-3’ ...
-
bioRxiv - Neuroscience 2024Quote: ... the miR-708-5p.T from CAG-eYFP-3x-miR708-5p-TS was amplified by PCR and inserted into WPRE-ab at the KpnI restriction enzyme site using the In- Fusion Cloning Kit (TaKaRa Bio, Shiga, Japan). To construct the plasmids ab-WPRE or ab- WPRE-ab (pAAV/mIba1.GFP.miR-9.T.miR-129-2-3p.T.WPRE.SV40pA or pAAV/mIba1.GFP.miR-9.T.miR-129-2-3p.T.WPRE.miR-9.T.miR-129-2-3p.T.SV40pA
-
bioRxiv - Genetics 2024Quote: ... Laccase2 expression was evaluated through RT-qPCR using the One Step TB Green® PrimeScript™ PLUS RT-PCR kit (Perfect Real Time) (Takara Bio) and the Roche LightCycler® 96 real-time PCR instrument (Roche Applied Science ...
-
bioRxiv - Molecular Biology 2021Quote: ... Quantitative real-time PCR was performed on a TP-850 Real-Time PCR Detection System (TAKARA Bio) using SYBR Green Premix ExTaq II ...
-
bioRxiv - Plant Biology 2020Quote: ... PCR was performed using the SYBR-Green PCR Master mix (SYBR® Premix Ex Taq™, Takara) and a CFX96 thermal cycler (BioRad) ...
-
bioRxiv - Immunology 2022Quote: ... and quantitative real-time PCR (q-PCR) was carried out using SYBR Premix Ex Taq (TaKaRa, Japan). Q-PCR was carried out in a Bio-Rad CFX96 system ...
-
bioRxiv - Molecular Biology 2020Quote: ... Reverse PCRs were performed in two rounds using CloneAmp HiFi PCR premix (Clontech, Mountain View, CA, USA). The first round was performed adding the forward and reverse primers in two independent reactions and consisted of 3 cycles of 98 °C for 10 seconds ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed by SYBR Green PCR Master Mix (Takara). The primer sequences for qRT-PCR were listed in Table S15.
-
bioRxiv - Developmental Biology 2024Quote: ... 1 ul of the cDNA was used for PCR reaction using CloneAmp HiFi PCR Premix (Takara, 639298) with the following primers ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1-st PCR (PCR 1) was performed using Titanium Taq DNA Polymerase (# 639209, Takara Bio, CA, USA). Separation of the PCR products from primers and gel purification was done by QIAquick PCR & Gel Cleanup Kit (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... Homology-directed repair templates were PCR amplified using the CloneAmp™ HiFi PCR Premix (Takara Bio, 639298). Guide RNA and repair template sequences are listed in Table S1.
-
bioRxiv - Molecular Biology 2024Quote: ... Quantitative reverse transcription-PCR (qRT-PCR) was performed using SYBR Green Master Mix (Takara, Otsu, Shiga, Japan) on the qTOWER³ Series (analytikjena ...
-
bioRxiv - Microbiology 2024Quote: ... Homology-directed repair templates were PCR amplified using the CloneAmp™ HiFi PCR Premix (Takara Bio, 639298). Guide RNA and repair template sequences are listed in Table S1.
-
bioRxiv - Microbiology 2024Quote: ... PCR reactions were carried out with a 2X Hot Start PCR Master Mix (TaKaRa; catalog no. R405A). A list of primers used for PCR is provided in Table S2 ...
-
bioRxiv - Microbiology 2024Quote: ... Full-length segments were then amplified from cDNA by PCR using CloneAmp HIFI PCR Premix (Takara, France) and then gel purified using NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel ...
-
bioRxiv - Cell Biology 2021Quote: ... Total RNA was normalized to 2ng in a total volume of 9μl and then transcribed to cDNA in a dedicated PCR clean workstation using the SMART-Seq v4 Ultra Low Input RNA Kit (Takara Bio, Mountain View, CA). Sequencing libraries were constructed from cDNA using the SMARTer ThruPLEX DNA-Seq kit (Takara Bio) ...
-
bioRxiv - Developmental Biology 2020Quote: ... The corresponding full-length cDNA library was then generated using 1μg total RNA and the SMARTer PCR cDNA synthesis kit (Clontech, Takara Bio Inc., Shiga, Japan) following PacBio recommendations set out in the Iso-Seq method ...
-
bioRxiv - Cell Biology 2022Quote: ... Deletion and point mutation constructs were produced through inverse PCR using Takara In-Fusion HD cloning kit (#638920) (Takara Bio Inc., Kusatsu, Shiga, Japan). Primers used are listed in supplementary materials.
-
bioRxiv - Neuroscience 2020Quote: ... and a portion (1 ng) of the RNA were subjected to reverse transcription (RT) with a SMARTer™ PCR cDNA Synthesis Kit (Clontech, Mountain View, CA). Then ...
-
bioRxiv - Microbiology 2022Quote: ... The resulting PCR product was then cloned into pVV16-hsp60 between NdeI and HinDIII using In-Fusion® HD cloning kit (Takara Bio USA, Inc) and Stellar™ competent cells ...
-
bioRxiv - Biochemistry 2023Quote: ... The PCR fragments of spike protein DNA were cloned into linearized pMRNAXP vector using In-Fusion® HD Cloning Kit (Clontech® Laboratories, Inc.). The cloning mixtures were transformed to One Shot™ TOP10 Chemically Competent E ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR reactions at every examined depth were performed in triplicate (n=3) using Takara SpeedSTAR HS DNA polymerase kit (Takara Bio USA, Madison, WI) with the following modifications ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Cancer Biology 2022Quote: Human c-Jun sequence was amplificated using the cDNA of MCF7-BM02-1 and then transferred to pMXd3-PEF1-IRES-Puro vector using an In-Fusion Advantage PCR Cloning Kit (Clontech Laboratories Inc., CA, USA). The sequence encoding the transactivation domain of c-Jun in pMXs-Jun-IH was kindly provided by Dr ...
-
bioRxiv - Microbiology 2022Quote: RT-PCR was performed in a single closed tube using a one-step RT-PCR kit (One Step PrimeScript III RT-qPCR Mix, with UNG; Takara Bio Inc., Kusatsu, Japan) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... qPCR expression analysis was conducted on cDNA derived from immunoprecipitated RNA of OT:RiboTag mice following reverse (SMARTer® PCR cDNA synthesis kit; Takara Bio Inc., Shiga, Japan).
-
bioRxiv - Plant Biology 2022Quote: ... Real-time PCR was performed on an ABI Prism 7500 Fast Real-Time PCR System using the SYBR Premix Ex Taq kit (Takara Bio Inc., Shiga, Japan) according to the instructions ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The rRNA genes (18S, ITS, 28S) were amplified by polymerase chain reaction (PCR) using the TaKaRa Ex Taq polymerase kit (TaKaRa Bio-medicals, Seoul, Korea). PCR cycling parameters and primer information were followed as in Shazib et al ...
-
bioRxiv - Plant Biology 2021Quote: ... The recombinant yeast strain was confirmed by PCR conducted with Matchmaker™ Insert Check PCR Mix (TAKARA, Japan). The full length of SlBES1.8 coding sequence was cloned into pGADT7 plasmid and subsequently transformed into the recombinant yeast strain ...
-
bioRxiv - Biochemistry 2020Quote: ... The quantification of gene transcripts was performed by quantitative PCR (Q-PCR) using SYBR Premix Ex Taq (TAKARA). All values were normalized to the level of β-actin mRNA ...
-
bioRxiv - Neuroscience 2020Quote: ... each cDNA was subjected to PCR genotyping using Emerald AMP HS PCR Master Mix (Takara Bio USA #RR330B) and primers shown in Supplementary Table S5 ...
-
bioRxiv - Microbiology 2021Quote: ... and target genes were amplified by conventional PCR (50 µL reactions) with EmeraldAmp GT PCR Master Mix (Takara Bio ...
-
bioRxiv - Plant Biology 2020Quote: ... Partial genomic sequences of CpPT1 were PCR amplified in these preparations using SapphireAmp Fast PCR Master Mix (Takara) and the primer pair citron_Fw and citron_Rv (Supplementary Table 8) ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR was performed with the PrimeSTAR Max DNA polymerase 2x hot-start PCR master mix (TaKaRa Bio, R045A). PCR products were purified using the AMPure XP PCR purification system (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR products covering the whole sesRNA region was generated with CloneAmp HiFi PCR Premix (Takara, Cat. No. 639298), and purified with NucleoSpin Gel and PCR Clean-up kit (Takara ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.6 μl PCR mix was dispensed to each well containing the following: 1× SeqAmp PCR buffer (Takara Bio), 0.025 U μl−1 of SeqAmp polymerase (Takara Bio ...
-
bioRxiv - Physiology 2023Quote: ... Reverse transcription (RT)-PCR was performed using the Emerald Amp MAX PCR master mix (Takara Bio, Shiga, Japan). Quantitative RT-PCR was performed using THUNDERBIRD SYBR qPCR MIX (TOYOBO Life Science ...
-
bioRxiv - Neuroscience 2023Quote: ... Quantitative RT-PCR was conducted on Bio-Rad CFX96 using the SYBR green PCR master mix (TaKaRa, Japan) with the primers listed in Appendix 1—key resources table ...
-
bioRxiv - Neuroscience 2024Quote: ... Quantitative PCR was performed on Thermo Piko Real 96 (Thermo) using SYBR Green PCR Master Mix (Takara #RR820A). The mRNA expression level was calculated by the 2−ΔΔCt method and the results were plotted by using tubulin as the reference gene ...
-
bioRxiv - Cell Biology 2024Quote: ... A promoter region in the Sirt1 promoter was amplified by PCR (Terra PCR Direct Red Dye Premix, Takara), the PCR product gel purified (Gel Extraction Kit ...