Labshake search
Citations for Takara Bio :
851 - 900 of 6736 citations for Onion Yellow Dwarf Virus OYDV PCR Kits since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... the plasmids were cleaved using restriction enzymes and purified using electrophoresis and NucleoSpin Gel & PCR Clean-up kit (Takara bio, Shiga, Japan). The copy number of each standard DNA was calculated based on the concentration quantified with the Qubit 3 Fluorometer (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... the RNAs of 150µl of the supernatant were extracted and quantified using Retro-X™ qRT-PCR Titration Kit (Takara, cat# 631453), according to the manufacturer instruction.
-
bioRxiv - Cell Biology 2022Quote: ... cDNA were amplified from the embryo RNA using PrimeScript™ II High Fidelity One Step RT-polymerase chain reaction (PCR) Kit (Takara, R026A) using the following primers ...
-
bioRxiv - Microbiology 2022Quote: ... The resulting probe reaction mixtures were electrophoresed on a 0.8% agarose gel for 30 min at 100 V and then gel purified with a NucleoSpin Gel and PCR Clean-up kit (Takara Bio USA). The EMSA binding reaction ...
-
bioRxiv - Molecular Biology 2022Quote: ... qPCR was performed using a One-Step SYBR Green Prime ScriptTM RT-PCR Kit II (Perfect Real Time, Clontech, Takara, Kyoto, Japan) with a Thermal Cycler Dice™ system (Takara ...
-
bioRxiv - Molecular Biology 2022Quote: ... qPCR was performed using a One-Step SYBR Green Prime ScriptTM RT-PCR Kit II (Perfect Real Time, Clontech, Takara, Kyoto, Japan) with a Thermal Cycler Dice™ system (Takara ...
-
bioRxiv - Molecular Biology 2022Quote: ... and amplified by PCR using a forward primer containing a T7 promoter sequence (Supplemental Table 10) with the Advantage HF 2 kit (Takara Bio 639124) and the following cycling conditions ...
-
bioRxiv - Microbiology 2023Quote: ... vRNA copy numbers of each virus stock were measured via RT-qPCR assay with the One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time) (TaKaRa, Cat# RR096A) as described previously [12] ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR products were analysed by gel electrophoresis and positive products were purified using the NucleoSpin Gel and PCR clean up kit (Clontech, Takara Bio) before being sent for sequencing by Eurofins Genomics (Germany) ...
-
bioRxiv - Cancer Biology 2024Quote: ... MYCN 5′ DEL and 3′ DEL deletion mutants were generated by restriction-free cloning using plasmid PCR amplification and overhang ligation using the In-Fusion Cloning Kit (Takara Bio 638910) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR products were cloned into a PCR linearized pEcgRNA-guide plasmid to make the pEcgRNA-guide-RT plasmid using In-fusion® HD-cloning kit (Takara Bio) following the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2023Quote: ... the PCR products were subcloned into EcoRV site of pBluescript SK- vector using In-Fusion® HD Cloning Kit (TaKaRa Bio, Japan) and sequenced with the M13 forward primer (5’-GTAAAACGACGGCCAG-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... Isolated DNA was amplified by PCR using Hot Start TaKaRa LA Taq kit to yield a 10-Kb product (Takara Biotechnology, #RR042A). Primers utilized were the following ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The PCR products were used as templates to synthesize specific dsRNA using the in vitro Transcription T7 Kit (TaKaRa Biotechnology, Dalian, China) (dsRNA-Vitro ...
-
bioRxiv - Microbiology 2023Quote: ... The resulting PCR fragment was subcloned into the KpnI-NotI site of the pCAGGS vector20 using In-Fusion HD Cloning Kit (Takara, Cat# Z9650N). Nucleotide sequences were determined by DNA sequencing services (Eurofins) ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative real-time PCR was performed to detect expression of genes was using the SYBR® Premix Ex Taq kit (Takara, Japan) according to the manufacturer’s instructions and an iQ™5 real-time PCR System (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2023Quote: ... The resulting PCR fragment was subcloned into the KpnI-NotI site of the pCAGGS vector10 using In-Fusion HD Cloning Kit (Takara, Cat# Z9650N). Nucleotide sequences were determined by DNA sequencing services (Eurofins) ...
-
bioRxiv - Immunology 2023Quote: ... The DNA product was purified from the gel slice using the PCR cleanup and gel extraction kits (740609.50, Takara Bio, Kusatsu, Shiga). The purified DNA was cleaned using AMPure XP (A63881 ...
-
bioRxiv - Genetics 2023Quote: ... The full-length cDNAs of SUH1 and BC10 were amplified using the Taq LA DNA polymerase PCR kit from Takara (https://takara.com/) with cDNA-specific primers (Supplementary Table S2) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Final NGS libraries were generated using 2ng of the purified 1st PCR product using the dual-indexing Illumina-compatible DNA HT Dual Index kit (Takara #R4000660,R400661). 2nd PCR products were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cell Biology 2024Quote: ... Constructs that express wrmScarlet-tagged V-ATPase components with gfp::unc-54 3’ UTR were generated using the In-Fusion Advantage PCR cloning kit (Clontech, Cat. #639621). The primers were listed in Extended Data Table 3.
-
bioRxiv - Biochemistry 2024Quote: ... Site-specific mutagenesis of DLK1 was performed using PCR according to the protocol of the PrimeSTAR mutagenesis basal kit (Takara, Shiga, Japan). The primer sequences are listed in Table S5.
-
bioRxiv - Cancer Biology 2023Quote: ... The virus particles were collected 24 hours and 48 hours after transfection and concentrated with Lenti-X™ Concentrator (Takara, California, USA, Cat#631232). The pellets were then resuspended with PBS ...
-
bioRxiv - Genetics 2020Quote: ... The PCR products were purified by Nucleospin® Gel and PCR Clean-up (740609-250; TAKARA).
-
bioRxiv - Genetics 2020Quote: ... eas and RhoGEF) for qRT-PCR were generated by PCR using Tks Gflex DNA Polymerase (TaKaRa) and gene-specific primers (Table S1) ...
-
bioRxiv - Microbiology 2020Quote: ... Both 1st PCR and 2nd PCR were performed by using PrimeSTAR HS DNA polymerase from Takara Bio ...
-
bioRxiv - Neuroscience 2020Quote: ... A 10,143 kb fragment was amplified by PCR in a thermal cycler (TaKaRa PCR Thermal Cycler) using the following primers ...
-
bioRxiv - Pathology 2021Quote: ... Mycoplasma contamination was confirmed by PCR using the TaKaRa PCR Mycoplasma Detection Set (Takara, Shiga, Japan).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Transcription template DNA fragments were amplified directly by PCR using PrimeStar Max PCR polymerase (Takara Bio), SPu-2 (5’–CAGTAAGCCAGATGCTACAC ...
-
bioRxiv - Cancer Biology 2021Quote: ... PCR and quantitative-PCR were performed with Takara Taq Hot Start Version (TaKaRa Biotechnology, Shiga, Japan) or Power SYBR Green PCR master mix (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... Linkers and the T7 tag were added using PCR and the CloneAmp HiFi PCR Premix (TakaRa). Mutants (N127143Q and motif substitutions ...
-
bioRxiv - Microbiology 2020Quote: ... Mutants (N127143Q and motif substitutions) were obtained by mutagenesis PCR using CloneAmp HiFi PCR Premix (TakaRa). The GFP-tagged N127143Q mutant was constructed by substitution of asparagines for glutamines at amino acids 127 and 143 by site-directed mutagenesis (Stratagene) ...
-
bioRxiv - Genomics 2020Quote: ... Used cDNA template was further split into two PCR reactions with Terra PCR Direct Polymerase (Takara) with the following program 98°C for 2min ...
-
bioRxiv - Pathology 2024Quote: ... Real-time PCR was performed by using an SYBR Green PCR Master Mix (TaKaRa, Dalian, China) and the primers listed in Appendix B.
-
bioRxiv - Microbiology 2024Quote: ... A genomic region encompassing the target sites was PCR-amplified using EmeraldAmp PCR Master Mix (TaKaRa) with appropriate primers listed on Table 2 from randomly selected colonies and the resulting fragments were subjected to Sanger sequencing ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR was used to generate the backbone and insert using CloneAmp HiFi PCR premix (Takara Bio) and the primers listed in Supplementary Table S2.
-
bioRxiv - Biochemistry 2024Quote: Assembly inserts were produced through two sequential PCR reactions with 2X CloneAmp HiFi PCR premix (Takara). Both reactions were performed in 25 μl volumes ...
-
bioRxiv - Microbiology 2020Quote: ... CloneAmp Hi-Fi PCR Premix (Takara) and the following PCR conditions were used to generate the amplicons ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR-amplified from pEGFP-C1 (Clontech), at the NheI-XhoI sites of the pCI-Neo vector and then by adding the fragment encoding GIGYF2 at the XhoI-NotI sites ...
-
bioRxiv - Cell Biology 2021Quote: ... or CloneAmp HiFi PCR Premix (Takara)) and sequences of plasmids were confirmed by Sanger sequencing (Microsynth ...
-
bioRxiv - Microbiology 2021Quote: ... 1× ExTaq PCR buffer (Takara, Clontech Laboratories ...
-
bioRxiv - Microbiology 2024Quote: ... PCR was performed using PrimeStarMax (TaKaRa), and the resulting products were checked on agarose gel (1% ...
-
bioRxiv - Molecular Biology 2023Quote: CloneAmp™ HiFi PCR Premix (Takara) and 1 µl DMSO were mixed in a total volume of 25 µl H2O ...
-
bioRxiv - Molecular Biology 2023Quote: ... including PCR using PrimeSTAR GXL (Takara), and DpnI treatment (Takara) ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR was performed using Phusion (Takara), following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2024Quote: ... PCR was performed with Gflex (TaKaRa) under the temperature profile of an initial denaturation at 94°C for 1 min followed by 30 cycles of 98°C for 10 s ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR with Advantage 2 (Takara 639207). 5 µL of ligation sample ...
-
bioRxiv - Genomics 2020Quote: RNA preparations of similar quality from adult mouse testis and sperm were used for constructing PacBio IsoSeq libraries (SMRT bell libraries). Full-length cDNA was synthesized using the Clontech SMARTer PCR cDNA Synthesis kit (Cat. # 634925) (Clontech, Palo Alto, CA). Approximately 13-15 PCR cycles were required to generate 10-15 µg of ds-cDNA from a 1 µg RNA sample ...
-
bioRxiv - Microbiology 2022Quote: The BLV pol gene was measured in the genomic DNA samples of blood and tissue samples of cattle using real-time PCR with a BLV Detection Kit (Takara Bio, Otsu, Japan) with a LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Developmental Biology 2020Quote: ... The corresponding full-length cDNA library was then generated using 1μg total RNA and the SMARTer PCR cDNA synthesis kit (Clontech, Takara Bio Inc., Shiga, Japan) following PacBio recommendations set out in the Iso-Seq method ...